Vaccine composition for porcine circovirus and swine influenza, preparation method and application
A technology of porcine circovirus and vaccine composition, applied in the fields of botanical equipment and methods, biochemical equipment and methods, applications, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] Example 1 Preparation, identification and purification of porcine circovirus and swine influenza virus H1N1 fusion antigen
[0070] 1.1 PCR amplification of PCV2Cap gene
[0071]Using the gene sequence of the PCV2-SH strain (accession number: HM038027) in GeneBank (see the sequence table for details, SEQ ID No.1) as a template, use the software Primer Premier 5.0 to design a pair of primers (702bp, 233AA) for the amplification of PCV2 -Cap gene, its two ends add BamH I and Pst I restriction site respectively, under (PH) promoter, primer sequence is as follows:
[0072] PCV2-Cap-BamH I: CGGGATCCATGACGTATCCAAGGAGGC
[0073] PCV2-Cap-Pst I: AACTGCAGTTAAGGGTTAAGTGTGGGGGC
[0074] The parameters of the PCR reaction are: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 50 s, annealing at 54.3°C for 30 s, extension at 72°C for 45 s, and after 35 cycles, extension at 72°C for 5 min; The product was identified, and PCV2-Cap gene DNA was recovered and purified with...
Embodiment 2
[0094] Example 2 Preparation, identification and purification of porcine circovirus and swine influenza virus H3N2 fusion antigen
[0095] 2.1 Sequence selection and primer setting
[0096] Using the gene sequence in GeneBank (accession number: CY107035.1) (see the sequence table for details, SEQ ID No.5) as a template, use the software Primer Premier 5.0 to design a pair of primers (663bp, 221AA) for amplifying the H3N2-HA2 gene , respectively adding Sma I and Kpn I restriction sites at its two ends, located under the P10 promoter, the primer sequences are as follows:
[0097] H3N2-HA2-Sma I upstream:
[0098] CCCCCGGGGGCATATTCGGCGCAATCGCAGGT
[0099] Downstream of H3N2-HA2-Kpn I:
[0100] GGGGTACCAATGCAAATGTTGCATCTAATGTTG
[0101] The parameters of the PCR reaction are: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 50 s, annealing at 53.8°C for 45 s, extension at 72°C for 40 s, and after 35 cycles, extension at 72°C for 5 min; The product was identified, ...
Embodiment 3
[0105] The preparation of embodiment 3 porcine circovirus, swine influenza virus vaccine composition
[0106] The porcine circovirus and porcine influenza virus fusion antigens prepared in Example 1-2 were diluted with PBS solution of pH 7.4 respectively, and the fusion antigens and mineral oil adjuvant diluted respectively were prepared as shown in Table 1, with 500 Stir at a speed of -800r / min for 10-15 min, add thimerosal solution with a volume ratio of 1% before stopping the stirring, so that the final concentration does not exceed 1 / 10,000, shake and mix well, and the vaccine composition 1. Vaccine Composition 2. Store it at 2-8°C after aliquoting.
[0107] Table 1 swine influenza virus, porcine circovirus vaccine composition ratio
[0108]
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap