Vaccine composition for porcine circovirus and swine influenza, preparation method and application

A technology of porcine circovirus and vaccine composition, applied in the fields of botanical equipment and methods, biochemical equipment and methods, applications, etc.

Active Publication Date: 2020-03-31
PU LIKE BIO ENG
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently no report of a vaccine combining the prevention and / or treatment of porcine circovirus disease with swine influenza

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine composition for porcine circovirus and swine influenza, preparation method and application
  • Vaccine composition for porcine circovirus and swine influenza, preparation method and application
  • Vaccine composition for porcine circovirus and swine influenza, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1 Preparation, identification and purification of porcine circovirus and swine influenza virus H1N1 fusion antigen

[0070] 1.1 PCR amplification of PCV2Cap gene

[0071]Using the gene sequence of the PCV2-SH strain (accession number: HM038027) in GeneBank (see the sequence table for details, SEQ ID No.1) as a template, use the software Primer Premier 5.0 to design a pair of primers (702bp, 233AA) for the amplification of PCV2 -Cap gene, its two ends add BamH I and Pst I restriction site respectively, under (PH) promoter, primer sequence is as follows:

[0072] PCV2-Cap-BamH I: CGGGATCCATGACGTATCCAAGGAGGC

[0073] PCV2-Cap-Pst I: AACTGCAGTTAAGGGTTAAGTGTGGGGGC

[0074] The parameters of the PCR reaction are: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 50 s, annealing at 54.3°C for 30 s, extension at 72°C for 45 s, and after 35 cycles, extension at 72°C for 5 min; The product was identified, and PCV2-Cap gene DNA was recovered and purified with...

Embodiment 2

[0094] Example 2 Preparation, identification and purification of porcine circovirus and swine influenza virus H3N2 fusion antigen

[0095] 2.1 Sequence selection and primer setting

[0096] Using the gene sequence in GeneBank (accession number: CY107035.1) (see the sequence table for details, SEQ ID No.5) as a template, use the software Primer Premier 5.0 to design a pair of primers (663bp, 221AA) for amplifying the H3N2-HA2 gene , respectively adding Sma I and Kpn I restriction sites at its two ends, located under the P10 promoter, the primer sequences are as follows:

[0097] H3N2-HA2-Sma I upstream:

[0098] CCCCCGGGGGCATATTCGGCGCAATCGCAGGT

[0099] Downstream of H3N2-HA2-Kpn I:

[0100] GGGGTACCAATGCAAATGTTGCATCTAATGTTG

[0101] The parameters of the PCR reaction are: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 50 s, annealing at 53.8°C for 45 s, extension at 72°C for 40 s, and after 35 cycles, extension at 72°C for 5 min; The product was identified, ...

Embodiment 3

[0105] The preparation of embodiment 3 porcine circovirus, swine influenza virus vaccine composition

[0106] The porcine circovirus and porcine influenza virus fusion antigens prepared in Example 1-2 were diluted with PBS solution of pH 7.4 respectively, and the fusion antigens and mineral oil adjuvant diluted respectively were prepared as shown in Table 1, with 500 Stir at a speed of -800r / min for 10-15 min, add thimerosal solution with a volume ratio of 1% before stopping the stirring, so that the final concentration does not exceed 1 / 10,000, shake and mix well, and the vaccine composition 1. Vaccine Composition 2. Store it at 2-8°C after aliquoting.

[0107] Table 1 swine influenza virus, porcine circovirus vaccine composition ratio

[0108]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The present invention relates to a vaccine composition for preventing and / or treating porcine circovirus disease and swine influenza and its preparation method and application. Circular virus subunit antigen and nucleic acid capable of being expressed in pigs, and ii) swine influenza virus subunit antigen or nucleic acid encoding swine influenza virus subunit antigen and capable of being expressed in pigs. The present invention also relates to nucleic acid molecules, recombinant plasmids and host cells for simultaneous treatment and / or prevention of two porcine diseases.

Description

technical field [0001] The invention relates to a vaccine composition and a preparation method thereof for simultaneous treatment and / or prevention of porcine circovirus disease and / or swine flu. The present invention also relates to nucleic acid molecules, recombinant plasmids and host cells for simultaneous treatment and / or prevention of two porcine diseases. The present invention further relates to the application of the vaccine composition in the preparation of medicaments. Background technique [0002] Porcine circovirus disease is mainly caused by porcine circovirus (Porcine circovirus, PCV). In addition to manifesting as porcine multisystemic wasting syndrome (Postweaning multisystemic wasting syndrome, PMWS), the disease is also combined with porcine dermatitis and nephropathy. Porcine dermatitis and nephropathy syndrome (PDNS), porcine respiratory disease complex (PRDC), proliferative and necrotizing pneumonia (PNP), congenital tremor (CT-All), etc. related diseas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K39/295A61K39/12A61K39/145C12N15/34C12N15/44C12N15/70C12N15/866C12N1/21C12N5/10A61P31/20A61P31/16
Inventor张许科孙进忠杨青原田克恭
OwnerPU LIKE BIO ENG