Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

T cell prepared product having HER2 specific TCR (human epidermal growth factor receptor-2 specific TCR T cell receptor) and application of T cell prepared product

A technology of cells and cell groups, applied in the field of immunology, can solve problems such as TCR pairing

Active Publication Date: 2016-07-27
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, there is a key technical problem in the TCR gene transfer technology, that is, the pairing of TCR α and β chains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • T cell prepared product having HER2 specific TCR (human epidermal growth factor receptor-2 specific TCR T cell receptor) and application of T cell prepared product
  • T cell prepared product having HER2 specific TCR (human epidermal growth factor receptor-2 specific TCR T cell receptor) and application of T cell prepared product
  • T cell prepared product having HER2 specific TCR (human epidermal growth factor receptor-2 specific TCR T cell receptor) and application of T cell prepared product

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1. Induction of specific CTLs recognizing HER2 / neu

[0039] Isolation and in vitro culture of dendritic cells (DCs) from HLA-A2.1 mice (JacksonLab) (A2 mice) using a human HER2 / neu(689) epitope peptide (RLLQETELV (SEQ ID NO: 11), designated RLL peptide) and an irrelevant control peptide MP-5866 to sensitize DCs. Then it was induced with bacterial lipopolysaccharide (Sigma) (LPS) to obtain mature DCs. Take 1×10 6 A2 mice were immunized with DC via tail vein injection. After repeated immunization 3-4 times (once a week), the spleen and lymph nodes of the mice were taken, T cells were isolated, and the lymphocytes were co-labeled with epitope peptide-specific tetramer (ProImmune) and CD8 fluorescent antibody (Invitrogen). The double-positive cells were detected by FACSCalibur flow cytometer (purchased from BectonDickinson, model: BDLSRII), and the results showed that RLL-specific CTLs were successfully induced, and the ratio of RLL-specific CTLs in lymph nodes w...

Embodiment 2

[0041] Example 2. Cloning of HER2 / neu specific TCR gene

[0042] Using the HER2-specific CTL cell cDNA sorted in Example 1 as a template, the HER2 antigen peptide-specific TCRα and β chain genes were cloned by 5' RACE-PCR technology. Gene-specific primers (GSP): TCRα chain GSP: aggagaagccccgcccctgccgt (SEQ ID NO:9, TM79.2°C); TCRβ chain GSP: cccaggcctctgcactgatgttc (SEQ ID NO:10, TM73.7°C). Synthesis of the first and second strands of cDNA was performed according to the kit (Clontec) instructions.

[0043] First-strand DNA (5'-RACE-ReadycDNA) was synthesized as follows:

[0044] 1. Mix 2 μL 5×firstStrandBuffer, 1 μL DTT (20 μm) and 1 μL dNTPMix (10 μm) to obtain a mixture A with a total volume of 4 μL;

[0045] 2. Mix 1.0-2.75 μL of RNA extracted from HER2-specific CTL and 1 μL of 5,-CDSprimerA and add water to a total volume of 3.75 μL, mix well and centrifuge to obtain mixture B;

[0046] 3. Put mixture B at 72°C for 3 minutes, then at 42°C for 2 minutes, and then centrif...

Embodiment 3

[0051] Example 3. Analysis of alpha and beta chain gene expression patterns of cloned HER2 / neu-specific TCRs

[0052] First, the pcDNA3.1 expression vector (Invitrogen) was used to construct the TCRα eukaryotic expression vector (Flag tag) and the TCRβ eukaryotic expression vector (HA tag), and transfected 293T cells respectively as follows: 293T cells were seeded into 6-well cells Culture plates at 37 °C, 5% CO 2 Incubate overnight in a cell incubator under the conditions of 1 μg; dissolve 1 μg TCRα-Flag plasmid or 1 μg TCRβ-HA plasmid in 100 μL of 50 nM NaCl solution to obtain solution I; dissolve 5-10 μL JetPEI transfection reagent (purchased from Polyplus) in 100 μL 50nM NaCl to obtain solution II, and let stand for 5 minutes; mix solutions I and II, and act at room temperature for 15 minutes, then add the mixture to the cells to be transfected, and transfect the cells for 48 hours.

[0053] Then, with Focus TM GlobalFractionKit (G-Biosciencesiosciences, Inc.) isolates m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a cell prepared product containing CD8+T cells. The invention also provides a method for preparing the cell prepared product containing the modified CD8+T cells, as well as application of the cell prepared product in treating HER2 positive tumors.

Description

technical field [0001] The present invention relates to the field of immunology, and particularly relates to a cell preparation that specifically recognizes a tumor expressing HER2, its preparation method and its use. Background technique [0002] T cells play an important role in antitumor immunity. However, in tumor patients, local specific cytotoxic T lymphocytes (CTLs) are rare, and it is difficult to obtain and expand them in vitro, and the low affinity of CTLs limits their application in the clinical treatment of tumors. Adoptive transfer of T cells is a specific and non-toxic anti-tumor method that has received high attention in recent years, and has a certain effect on the treatment of hematological and solid tumors. In T cell adoptive transfer, T cell receptor (TCR) gene transfer is a rapidly developing immunotherapy approach. TCR gene transfer technology is to clone the α and β chains of TCR from tumor-reactive T cells. Through genetic engineering technology, ret...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/0783C12N15/85C12N15/13A61K35/17A61P35/00
Inventor 王春梅刘音赵锴刘洋温巧莲曹雪涛
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com