T cell prepared product having HER2 specific TCR (human epidermal growth factor receptor-2 specific TCR T cell receptor) and application of T cell prepared product
A technology of cells and cell groups, applied in the field of immunology, can solve problems such as TCR pairing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1. Induction of specific CTLs recognizing HER2 / neu
[0039] Isolation and in vitro culture of dendritic cells (DCs) from HLA-A2.1 mice (JacksonLab) (A2 mice) using a human HER2 / neu(689) epitope peptide (RLLQETELV (SEQ ID NO: 11), designated RLL peptide) and an irrelevant control peptide MP-5866 to sensitize DCs. Then it was induced with bacterial lipopolysaccharide (Sigma) (LPS) to obtain mature DCs. Take 1×10 6 A2 mice were immunized with DC via tail vein injection. After repeated immunization 3-4 times (once a week), the spleen and lymph nodes of the mice were taken, T cells were isolated, and the lymphocytes were co-labeled with epitope peptide-specific tetramer (ProImmune) and CD8 fluorescent antibody (Invitrogen). The double-positive cells were detected by FACSCalibur flow cytometer (purchased from BectonDickinson, model: BDLSRII), and the results showed that RLL-specific CTLs were successfully induced, and the ratio of RLL-specific CTLs in lymph nodes w...
Embodiment 2
[0041] Example 2. Cloning of HER2 / neu specific TCR gene
[0042] Using the HER2-specific CTL cell cDNA sorted in Example 1 as a template, the HER2 antigen peptide-specific TCRα and β chain genes were cloned by 5' RACE-PCR technology. Gene-specific primers (GSP): TCRα chain GSP: aggagaagccccgcccctgccgt (SEQ ID NO:9, TM79.2°C); TCRβ chain GSP: cccaggcctctgcactgatgttc (SEQ ID NO:10, TM73.7°C). Synthesis of the first and second strands of cDNA was performed according to the kit (Clontec) instructions.
[0043] First-strand DNA (5'-RACE-ReadycDNA) was synthesized as follows:
[0044] 1. Mix 2 μL 5×firstStrandBuffer, 1 μL DTT (20 μm) and 1 μL dNTPMix (10 μm) to obtain a mixture A with a total volume of 4 μL;
[0045] 2. Mix 1.0-2.75 μL of RNA extracted from HER2-specific CTL and 1 μL of 5,-CDSprimerA and add water to a total volume of 3.75 μL, mix well and centrifuge to obtain mixture B;
[0046] 3. Put mixture B at 72°C for 3 minutes, then at 42°C for 2 minutes, and then centrif...
Embodiment 3
[0051] Example 3. Analysis of alpha and beta chain gene expression patterns of cloned HER2 / neu-specific TCRs
[0052] First, the pcDNA3.1 expression vector (Invitrogen) was used to construct the TCRα eukaryotic expression vector (Flag tag) and the TCRβ eukaryotic expression vector (HA tag), and transfected 293T cells respectively as follows: 293T cells were seeded into 6-well cells Culture plates at 37 °C, 5% CO 2 Incubate overnight in a cell incubator under the conditions of 1 μg; dissolve 1 μg TCRα-Flag plasmid or 1 μg TCRβ-HA plasmid in 100 μL of 50 nM NaCl solution to obtain solution I; dissolve 5-10 μL JetPEI transfection reagent (purchased from Polyplus) in 100 μL 50nM NaCl to obtain solution II, and let stand for 5 minutes; mix solutions I and II, and act at room temperature for 15 minutes, then add the mixture to the cells to be transfected, and transfect the cells for 48 hours.
[0053] Then, with Focus TM GlobalFractionKit (G-Biosciencesiosciences, Inc.) isolates m...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com