A strong expression promoter safes7 in stems and leaves of rice and its application
A promoter and rice technology, applied in the fields of biotechnology and crop genetic engineering, can solve the problems of rare promoters, achieve the effects of reducing adverse effects, improving environmental tolerance, and increasing yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] The acquisition of embodiment 1 promoter SAFES7
[0054] Step 1. Design of primers
[0055] According to the whole genome sequence of rice variety Nipponbare provided by NCBI, and according to the characteristics of the selected vector and target gene, design amplification primers, and add restriction endonuclease HindIII and EcoRI recognition sites and protective bases at both ends of the primers .
[0056] In this embodiment, the rice binary expression vector pCAMBIA1391 is taken as an example, the target gene is the Gus gene, and the designed primers are as follows (SEQ ID No: 3-4):
[0057] SAFES7HindIII FP: AAGCTT CTGCTGGATCTCCCACACGCTC
[0058] SAFES7 EcoRI RP: GAATTC AGAGGGCATCCATGGCTACTCG
[0059] Wherein AAGCTT is the recognition site and protection base of the restriction endonuclease HindIII;
[0060] GAATTC is the recognition site and protective base of the restriction endonuclease EcoRI.
[0061] Primers were synthesized by Shenzhen Huada Gene Comp...
Embodiment 2
[0066] Example 2 Functional verification of the promoter SAFES7
[0067] 1. Construction of recombinant expression vector and transformation of Agrobacterium
[0068] Plasmids were extracted from the positive clones obtained in Example 1, double digested with HindIII and EcoRI, and the promoter SAFES7 fragment was recovered. At the same time, HindIII and EcoRI were used to linearize pCAMBIA1391, recover pCAMBIA1391, and connect the above-mentioned SAFES7 fragment and pCAMBIA1391 fragment with T4DNA ligase (purchased from TaKaRa Company) to obtain the crop expression vector pCAMBIA1391- SAFES7( figure 1 B), the crop expression vector was transformed into Agrobacterium tumefaciens EHA105 by freeze-thaw method.
[0069] 2. Agrobacterium-mediated genetic transformation of rice
[0070] After the chaff is removed from the mature rice seeds, the seeds are soaked in 70% alcohol for 1 min, and the alcohol is poured off. Soak the seeds for 40 minutes (150 r / min) with a solution of ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com