Unlock instant, AI-driven research and patent intelligence for your innovation.

A strong expression promoter safes7 in stems and leaves of rice and its application

A promoter and rice technology, applied in the fields of biotechnology and crop genetic engineering, can solve the problems of rare promoters, achieve the effects of reducing adverse effects, improving environmental tolerance, and increasing yield

Active Publication Date: 2019-04-12
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there are not many promoters for stem-leaf-specific expression reported so far. Therefore, it is necessary to discover more stem-leaf promoters with stronger expression specificity for application in crop production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A strong expression promoter safes7 in stems and leaves of rice and its application
  • A strong expression promoter safes7 in stems and leaves of rice and its application
  • A strong expression promoter safes7 in stems and leaves of rice and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] The acquisition of embodiment 1 promoter SAFES7

[0054] Step 1. Design of primers

[0055] According to the whole genome sequence of rice variety Nipponbare provided by NCBI, and according to the characteristics of the selected vector and target gene, design amplification primers, and add restriction endonuclease HindIII and EcoRI recognition sites and protective bases at both ends of the primers .

[0056] In this embodiment, the rice binary expression vector pCAMBIA1391 is taken as an example, the target gene is the Gus gene, and the designed primers are as follows (SEQ ID No: 3-4):

[0057] SAFES7HindIII FP: AAGCTT CTGCTGGATCTCCCACACGCTC

[0058] SAFES7 EcoRI RP: GAATTC AGAGGGCATCCATGGCTACTCG

[0059] Wherein AAGCTT is the recognition site and protection base of the restriction endonuclease HindIII;

[0060] GAATTC is the recognition site and protective base of the restriction endonuclease EcoRI.

[0061] Primers were synthesized by Shenzhen Huada Gene Comp...

Embodiment 2

[0066] Example 2 Functional verification of the promoter SAFES7

[0067] 1. Construction of recombinant expression vector and transformation of Agrobacterium

[0068] Plasmids were extracted from the positive clones obtained in Example 1, double digested with HindIII and EcoRI, and the promoter SAFES7 fragment was recovered. At the same time, HindIII and EcoRI were used to linearize pCAMBIA1391, recover pCAMBIA1391, and connect the above-mentioned SAFES7 fragment and pCAMBIA1391 fragment with T4DNA ligase (purchased from TaKaRa Company) to obtain the crop expression vector pCAMBIA1391- SAFES7( figure 1 B), the crop expression vector was transformed into Agrobacterium tumefaciens EHA105 by freeze-thaw method.

[0069] 2. Agrobacterium-mediated genetic transformation of rice

[0070] After the chaff is removed from the mature rice seeds, the seeds are soaked in 70% alcohol for 1 min, and the alcohol is poured off. Soak the seeds for 40 minutes (150 r / min) with a solution of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rice stem and leaf strong expression promoter SAFES7 and application thereof. The present invention discovers, isolates and identifies the sequence of the promoter from rice. Specifically, the present invention uses DNA recombination technology to construct a transformation vector that drives the GUS reporter gene from the rice stem and leaf strong expression promoter SAFES7. Through transformation experiments on model crops, it is identified that the promoter is characterized by driving the target gene in It is expressed in tissues such as stems, leaves, and leaf sheaths, but not in roots, embryos, and endosperm cells. The research and application of such promoters not only help to elucidate the biological functions of related genes, but also provide material basis and multiple options for crop transgenic safety research using such promoters in crop genetic engineering.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and crop genetic engineering, in particular to a rice stem and leaf strong expression promoter SAFES7 and its application. Background technique [0002] The promoter is an important cis-element for gene expression regulation, and transcription factors bind to it to activate or repress gene transcription. Therefore, the promoter is necessary for gene expression and determines the expression pattern of the target gene to a large extent. The use of specific promoters to precisely control the time, location and quantity of target gene product generation is very important to improve the pertinence and timeliness of target gene expression, save energy, reduce metabolic burden, and reduce the adverse effects of other traits. An important aspect of risk prevention and control capabilities. [0003] The stem plays the role of transmitting nutrients and supporting in the process of plant growth and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/82C12N15/84A01H5/00A01H6/46
CPCC07K14/415C12N15/8205C12N15/8225C12N15/8226
Inventor 李娟杨剑波李浩李莉杨亚春魏鹏程秦瑞英许蓉芳
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More