Supercharge Your Innovation With Domain-Expert AI Agents!

Jellyfish toxin polypeptide, preparation and application

A jellyfish toxin, jellyfish technology, applied in the fields of biochemistry and molecular biology, can solve the problem of no research reports, and achieve the effect of non-addiction

Inactive Publication Date: 2016-08-17
SUZHOU PULUODA BIOLOGICAL SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, there are no relevant research reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Jellyfish toxin polypeptide, preparation and application
  • Jellyfish toxin polypeptide, preparation and application
  • Jellyfish toxin polypeptide, preparation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Polypeptides are synthesized by chemical synthesis: the polypeptides are synthesized by Fmoc chemical method. The synthesis reaction is carried out from the C-terminal to the N-terminal, and there are free amino groups on the Rink medium (available from Advanced ChemTech Company), and the amino acids are connected in the order from the C-terminal to the N-terminal. During each ligation step, the amino acid residues are activated, and the activation mixture contains 4 times as many HBTU, HOBt, DIEA and Fmoc-amino acids as there are free amino groups on the medium. After each amino acid attachment reaction, a pyridine / acetic acid / N-methylimidazole mixture was used to block the unattached free amino groups. After each amino acid linking reaction and before the next amino acid linking, the Fmoc-group on the medium should be removed, and the Fmoc-group should be removed using dimethylformamide containing 20% ​​piperidine. Finally, after all amino acid residues are linked se...

Embodiment 2

[0018] The jellyfish is used as a raw material, and the nucleotide capable of encoding the jellyfish toxin polypeptide is expressed by a gene recombination method to obtain the polypeptide. Extract DNA from jellyfish as a template for polymerase chain reaction; add primers, the primer sequence is: the upstream sequence is 5`-CTTAGGAGCTGTCGCTTCATT-3`, the downstream sequence is 5`-AAACCATCCTGTGCGAAAAG-3`, after denaturation and extension , renaturation, the DNA chain is replicated in vitro, and the DNA chain contains a polynucleotide capable of encoding the polypeptide, the sequence is:

[0019] TATGGAGTTGGCTTAGGAGCTGTCGCTTCATTGTTATCGTCTGTAATAGGGCTTTTCGCACAGGATGGTTTTAAGAAC; cut off the polynucleotide encoding the jellyfish toxin polypeptide with endonuclease, and purify; use ligase to connect the polynucleotide and pBR322 vector to make a plasmid; transform the prepared plasmid into competent Escherichia coli ; identify and screen the Escherichia coli transformed into the plasm...

Embodiment 3

[0021] Using square jellyfish as a raw material, the method of gene recombination is used to express the nucleotide capable of encoding jellyfish toxin polypeptide to obtain the polypeptide. Extract DNA from the jellyfish as a template for polymerase chain reaction; add primers, the primer sequence is: the upstream sequence is 5`-CTTAGGAGCTGTCGCTTCATT-3`, the downstream sequence is 5`-AAACCATCCTGTGCGAAAAG-3`, after denaturation and extension , renaturation, the DNA chain is replicated in vitro, and the DNA chain contains a polynucleotide capable of encoding the polypeptide, the sequence is:

[0022] TATGGAGTTGGCTTAGGAGCTGTCGCTTCATTGTTATCGTCTGTAATAGGGCTTTTCGCACAGGATGGTTTTAAGAAC; cut off the polynucleotide encoding jellyfish toxin polypeptide with endonuclease, and purify; use ligase to connect the polynucleotide and pUC18 vector to make a plasmid; transform the prepared plasmid into competent Escherichia coli ; identify and screen the Escherichia coli transformed into the plasm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a jellyfish toxin polypeptide, belongs to the field of biological chemistry and molecular biology and particularly relates to a jellyfish toxin polypeptide, preparation and application. The amino acid sequence is a bran-new sequence. The polypeptide is synthesized chemically; or a gene recombination method is adopted for expressing polynucleotide capable of coding the polypeptide, and the polypeptide is obtained. The jellyfish toxin polypeptide is used for anesthesia and pain easing in operations. The jellyfish toxin polypeptide, preparation and application have the advantages that the jellyfish toxin polypeptide is used for general anesthesia and pain easing in operations, does not act on an opiate receptor and is free of addiction.

Description

technical field [0001] The invention belongs to the fields of biochemistry and molecular biology, and specifically relates to the preparation and application of a jellyfish toxin polypeptide. Background technique [0002] Pain is a protective response produced by the body after being subjected to noxious stimuli, and it is also a symptom of certain diseases. Severe pain is not only reflected in sensory pain and emotional uneasiness, but also can lead to physiological dysfunction, insomnia, and even shock and life-threatening. Therefore, clinically appropriate use of analgesics to relieve severe pain and prevent shock is necessary. Analgesics mainly act on the central nervous system, selectively inhibit and relieve all kinds of pain, relieve pain and cause fear, tension and anxiety, while analgesic does not affect other senses such as perception and hearing, and can maintain a clear mind. [0003] Pain-relieving drugs can be divided into two categories according to their ph...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/70A61K38/17A61P25/04A61P23/00
CPCA61K38/00C07K14/43595
Inventor 罗瑞雪
Owner SUZHOU PULUODA BIOLOGICAL SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More