Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chimeric antigen receptor as well as gene and recombinant expression vector, engineered CD30-targeted NKT cell and application thereof

A chimeric antigen receptor and NKT cell technology, applied in the field of tumor biological products, can solve the problems of insufficient distribution of CD30 monoclonal antibody and transient targeting effect of CD30 monoclonal antibody, achieve good industrial application prospects, and strengthen specific killing Activity, effect of prolonging survival time

Inactive Publication Date: 2016-08-17
CELLULAR BIOMEDICINE GRP SHANGHAI
View PDF2 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in the process of treating patients with relapsed and refractory Hodgkin's lymphoma, clinical research usually adopts the regimen of CD30 monoclonal antibody combined with cytotoxic drugs or radioactive isotopes. Certain defects, such as: transient targeting effect of CD30 monoclonal antibody and insufficient distribution of CD30 monoclonal antibody in the tumor site, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor as well as gene and recombinant expression vector, engineered CD30-targeted NKT cell and application thereof
  • Chimeric antigen receptor as well as gene and recombinant expression vector, engineered CD30-targeted NKT cell and application thereof
  • Chimeric antigen receptor as well as gene and recombinant expression vector, engineered CD30-targeted NKT cell and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0026] The preparation method of the lentiviral expression vector pWPT-CD30ScFv-CD8-CD137-CD3ζ is not particularly limited, and can be various methods that can be conceived by those skilled in the art. Preferably, the lentiviral expression vector pWPT-CD30ScFv-CD8-CD137 -The preparation method of CD3ζ includes the following steps:

[0027] (1) Amplify the hinge region and transmembrane region of CD8, the intracellular signal domain of CD137 and the intracellular signal domain of CD3ζ from NKT cell cDNA, and clone them into the vector pWPT-GFP to construct pWPT-CD8 -CD137-CD3ζ;

[0028] (2) The nucleotide sequence encoding rat growth hormone signal peptide and CD30ScFv was synthesized and cloned into pWPT-CD8-CD137-CD3ζ. After sequencing verification, the correct sequence of pWPT-CD30ScFv-CD8-CD137-CD3ζ was obtained.

[0029] In step (1), there is no particular limitation on the method of amplifying the hinge region and transmembrane region of CD8, the intracellular signal domain of ...

Embodiment 1

[0063] Example 1 Preparation of NKT cells

[0064] (1) Take human venous blood in a vacuum tube containing heparin. Using lymphocyte separation fluid, mononuclear cells (PBMCs) were obtained by density gradient centrifugation.

[0065] (2) After washing PBMCs three times, use NKT cell culture medium GT-T551 containing 0.6% fetal bovine serum to adjust the final cell concentration to 2×10 6 Cells / mL; inoculate the cells in 75cm coated with a final concentration of 5μg / mL CD3 monoclonal antibody and a final concentration of 10μg / mL retronectin 2 Cell culture flask. Then, add recombinant human interferon-γ with a final concentration of 1000 U / mL and recombinant human interleukin 2 with a final concentration of 1000 U / mL to the culture medium, at 37°C and saturated humidity of 5% CO 2 Cultivate in an incubator.

[0066] (3) On the fourth day, add 100 mL of NKT cell culture medium GT-T551 containing 0.6% fetal bovine serum to the culture flask, and add recombinant human interleukin 2 at ...

Embodiment 2

[0067] Example 2 Construction of lentiviral expression vector pWPT-CD30ScFv-CD8-CD137-CD3ζ

[0068] (1) Preparation of NKT cell cDNA

[0069] Centrifuge the NKT cells cultured in Example 1, extract the total RNA of the cells with the total RNA extraction kit RNAisoReagent, and store at -80°C for later use. RevertAid RevertAid Reverse Transcription Kit for Total RNA Extracted TM First Strand cDNA Synthesis Kit reverse transcribed NKT cell cDNA, stored at -20℃ for later use.

[0070] (2) Preparation of lentiviral plasmid pWPT-CD8-CD137-CD3ζ

[0071] Design and synthesize the following primer sequences (wherein, the underlined mark is the protective base, and the box is the restriction site):

[0072] P1 (SEQID NO.11): GATC CTGAGCAACTCCATCATGTACTTC

[0073] MluI

[0074] P2 (SEQID NO.12): GATC GCAGTAAAGGGTGATAACCAGTGA

[0075] BglII

[0076] P3 (SEQID NO.13): GATC AAACGGGGCAGAAAGAAACTCC

[0077] BglII

[0078] P4 (SEQID NO.14): GATC CAGTTCACATCCTCCTTCTTCTTCT

[0079] EcoRI

[0080] P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chimeric antigen receptor as well as a gene and a recombinant expression vector, an engineered CD30-targeted NKT cell and an application thereof. The chimeric antigen receptor is CD30ScFv-CD8-CD137-CD3 zeta, which comprises CD30ScFv, a hinge region and a transmembrane region of CD8, an intracellular signal structural domain of CD137, and an intracellular signal structural domain of CD3 zeta which are connected in series connection. The chimeric antigen receptor CD30ScFv-CD8-CD137-CD3 zeta modified NKT cell is used for treating CD30-positive Hodgkin lymphoma and non-Hodgkin's lymphoma; the chimeric antigen receptor has a good and specific killing activity for lymphoma cells, and has a certain treatment effects for CD30-positive Hodgkin lymphoma patients who have been treated for many times without obvious curative effects (such as CD30 monoclonal antibody combined with cytotoxin medicines or radio isotope therapy and the like).

Description

Technical field [0001] The present invention belongs to the field of tumor biological products, in particular, it relates to a chimeric antigen receptor CD30ScFv-CD8-CD137-CD3ζ and its gene and recombinant expression vector in adoptive immunotherapy, and engineered CD30 targeting NKT cells (CAR30 -NKT cells) and its applications. Background technique [0002] Natural killer cells (NKT) are a special type of T lymphocyte subgroup with dual properties of T cells and NK cells. NKT cells can express TCR of T cells and NKR-P1 of NK cells. Under the mediation of TCR and NKR, NKT cells can produce a large amount of IL-4 and INFγ, which can kill tumor cells. NKT cells bind to the Fc segment of specific antibodies through CD16 on their surface, and exert ADCC (antibody-dependent cell-mediated cytotoxicity) effects. However, in the process of antibody-dependent cell-mediated killing, since the antibody can specifically bind to the corresponding epitope on the target cell, NKT cells can k...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10A61K35/17A61P35/00
CPCC07K19/00C12N5/10C12N15/62C12N15/867A61K39/464417A61K2239/48A61K39/4613A61K39/4631A61K2239/31A61K2239/38
Inventor 伍志强韩为东王瑶郭业磊代汉仁王晓慧王春萌
Owner CELLULAR BIOMEDICINE GRP SHANGHAI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com