Chimeric antigen receptor as well as gene and recombinant expression vector, engineered CD30-targeted NKT cell and application thereof
A chimeric antigen receptor and NKT cell technology, applied in the field of tumor biological products, can solve the problems of insufficient distribution of CD30 monoclonal antibody and transient targeting effect of CD30 monoclonal antibody, achieve good industrial application prospects, and strengthen specific killing Activity, effect of prolonging survival time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0026] The preparation method of the lentiviral expression vector pWPT-CD30ScFv-CD8-CD137-CD3ζ is not particularly limited, and can be various methods that can be conceived by those skilled in the art. Preferably, the lentiviral expression vector pWPT-CD30ScFv-CD8-CD137 -The preparation method of CD3ζ includes the following steps:
[0027] (1) Amplify the hinge region and transmembrane region of CD8, the intracellular signal domain of CD137 and the intracellular signal domain of CD3ζ from NKT cell cDNA, and clone them into the vector pWPT-GFP to construct pWPT-CD8 -CD137-CD3ζ;
[0028] (2) The nucleotide sequence encoding rat growth hormone signal peptide and CD30ScFv was synthesized and cloned into pWPT-CD8-CD137-CD3ζ. After sequencing verification, the correct sequence of pWPT-CD30ScFv-CD8-CD137-CD3ζ was obtained.
[0029] In step (1), there is no particular limitation on the method of amplifying the hinge region and transmembrane region of CD8, the intracellular signal domain of ...
Embodiment 1
[0063] Example 1 Preparation of NKT cells
[0064] (1) Take human venous blood in a vacuum tube containing heparin. Using lymphocyte separation fluid, mononuclear cells (PBMCs) were obtained by density gradient centrifugation.
[0065] (2) After washing PBMCs three times, use NKT cell culture medium GT-T551 containing 0.6% fetal bovine serum to adjust the final cell concentration to 2×10 6 Cells / mL; inoculate the cells in 75cm coated with a final concentration of 5μg / mL CD3 monoclonal antibody and a final concentration of 10μg / mL retronectin 2 Cell culture flask. Then, add recombinant human interferon-γ with a final concentration of 1000 U / mL and recombinant human interleukin 2 with a final concentration of 1000 U / mL to the culture medium, at 37°C and saturated humidity of 5% CO 2 Cultivate in an incubator.
[0066] (3) On the fourth day, add 100 mL of NKT cell culture medium GT-T551 containing 0.6% fetal bovine serum to the culture flask, and add recombinant human interleukin 2 at ...
Embodiment 2
[0067] Example 2 Construction of lentiviral expression vector pWPT-CD30ScFv-CD8-CD137-CD3ζ
[0068] (1) Preparation of NKT cell cDNA
[0069] Centrifuge the NKT cells cultured in Example 1, extract the total RNA of the cells with the total RNA extraction kit RNAisoReagent, and store at -80°C for later use. RevertAid RevertAid Reverse Transcription Kit for Total RNA Extracted TM First Strand cDNA Synthesis Kit reverse transcribed NKT cell cDNA, stored at -20℃ for later use.
[0070] (2) Preparation of lentiviral plasmid pWPT-CD8-CD137-CD3ζ
[0071] Design and synthesize the following primer sequences (wherein, the underlined mark is the protective base, and the box is the restriction site):
[0072] P1 (SEQID NO.11): GATC CTGAGCAACTCCATCATGTACTTC
[0073] MluI
[0074] P2 (SEQID NO.12): GATC GCAGTAAAGGGTGATAACCAGTGA
[0075] BglII
[0076] P3 (SEQID NO.13): GATC AAACGGGGCAGAAAGAAACTCC
[0077] BglII
[0078] P4 (SEQID NO.14): GATC CAGTTCACATCCTCCTTCTTCTTCT
[0079] EcoRI
[0080] P...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com