Supercharge Your Innovation With Domain-Expert AI Agents!

Identification method of upland cotton sub-okra leaf germplasm materials and special primers of method

An identification method, a technology of upland cotton, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of affecting the quality of machine-picked cotton, poor management, and shedding of cotton bolls in the middle and lower parts, and achieve The identification results are stable and reliable, the effect of improving selection efficiency and speeding up the breeding process

Active Publication Date: 2016-08-24
SHANDONG COTTON RES CENT
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The normal leaf shape is duck-palm type, the leaf cracks are shallow, and the leaf area is large. Poor management usually easily causes the cotton canopy to be covered, and the middle and lower cotton bolls will fall off due to insufficient light. In rainy years, it is easy to cause rotten bolls and affect Spraying effect of defoliant affects the quality of machine-picked cotton

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification method of upland cotton sub-okra leaf germplasm materials and special primers of method
  • Identification method of upland cotton sub-okra leaf germplasm materials and special primers of method
  • Identification method of upland cotton sub-okra leaf germplasm materials and special primers of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment one. A kind of identification method of upland cotton sub-chicken foot leaf germplasm material, the steps are as follows:

[0027] 1. Take fresh young leaves of upland cotton material at the seed or seedling stage, extract genomic DNA, test the DNA quality, and dilute to 50ng / ul;

[0028] 2. According to the known cotton EST series, SSRhunter software designed a pair of specific SSR marker primers, forward primer: 5'-GATGCACCAGATCCTTTTAT-3' (SEQ ID No.1); reverse primer: 5'-GGTACATCGGAATCACAGT-3' ( SEQ ID No. 2).

[0029] The EST sequence of the designed primer is as follows (SEQ ID No.3), and the underline indicates the position of the primer.

[0030] CTGGACTAACACCAATAATCACTAAACTTTGATTAAAATAACATTTCAGTTACTAAACTTTCAAAAGTGACAAATCAGTCATTAACATTTACGAAAAGTGACAAATTAGTCACCTGAGAGTGGACATCTGACGTGGCCCGTTAGGGTGCCACGTTGAACATGATCG GATGC ACCAGATCCTTTTAT TAGTTTTATAAGGATTACCAACTAAATAGAAGAAGAAGAAGAAGAGGAAGAAGAAGAAGAAAAGGAAGAAGAAGAAGAAGAATAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA...

Embodiment 2

[0036] Embodiment two. Carry out the identification of sub-chicken foot leaf to 100 samples with the inventive method

[0037] 1. Materials:

[0038] Using the normal broad-leaved material Lumianyan No. 28 as the female parent and the homozygous material S131189 of the sub-chicken's foot leaf as the male parent, a sub-chicken's foot leaf and normal broad-leaved F 2 group.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an identification method of upland cotton sub-okra leaf germplasm materials and special primers of the identification method. With the adoption of the identification method and the special primers of the identification method, early rapid identification can be performed on sub-okra leaf characters of the upland cotton sub-okra leaf germplasm materials, and the breeding process is accelerated. Genome DNA of to-be-tested upland cotton is taken as templates, the specific primers are used for PCR (polymerase chain reaction) amplification, judgment is performed according to banding patterns of PCR products on gel, the materials only containing the 230-bp banding pattern are sub-okra leaf homozygotes, the materials containing the 200-bp banding pattern are normal broad leaves, and the materials containing both the 230-bp banding pattern and the 200-bp banding pattern are sub-okra leaf heterozygotes. With the adoption of the identification method and the special primers of the identification method, the purity of the sub-okra leaf germplasm materials can be identified indoors by the aid of seeds or plantlets, the breeding process can be accelerated, and the selection efficiency of excellent sub-okra leaf homozygous materials can be improved.

Description

technical field [0001] The invention relates to an identification method and a special primer for an upland cotton subchicken foot leaf germplasm material, which belongs to the field of cotton molecular biology application. Background technique [0002] Cotton is an important economic crop in my country, and its main product, cotton fiber, is an important raw material for the textile industry and plays an irreplaceable role in the textile industry. Leaves are important photosynthetic organs of cotton, responsible for converting light energy into carbohydrates for plant growth and development. The change of leaf shape has a great influence on the growth and development of cotton, and then affects the yield and quality of cotton fiber. The leaf shape of upland cotton can be divided into normal leaf and deeply lobed leaf. The normal leaf shape is duck-palm type, the leaf cracks are shallow, and the leaf area is large. Poor management usually easily causes the cotton canopy to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13
Inventor 赵军胜姜辉高明伟王家宝王秀丽陈莹张超
Owner SHANDONG COTTON RES CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More