Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of nanobody specifically binding prrs virus non-structural protein nsp4 and application thereof

A technology of non-structural proteins and nanobodies, applied in antiviral immunoglobulins, viruses/phages, retroRNA viruses, etc., can solve the problems of no specific antiviral drugs and limited protective effect

Active Publication Date: 2019-08-06
NORTHWEST A & F UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disease has caused huge economic losses to the pig industry in my country, but due to the characteristics of PRRS virus antigen variability, macrophage, antibody-dependent enhancement (ADE) and persistent infection (Chand R J: Pathogenesis of porcine reproductive and respiratory syndrome virus.Curr Opin Virol, 2012, 2(3):256-263), the protective effect of existing vaccines on this disease is very limited, and there is no specific antiviral drug for this disease at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of nanobody specifically binding prrs virus non-structural protein nsp4 and application thereof
  • A kind of nanobody specifically binding prrs virus non-structural protein nsp4 and application thereof
  • A kind of nanobody specifically binding prrs virus non-structural protein nsp4 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: Construction of Nanobody Library against PRRS virus nonstructural protein Nsp4:

[0020] (1) Mix 5ml Nsp4 recombinant protein (1mg / m1) with Freund's adjuvant in equal volume and emulsify evenly, and immunize an Alxa Bactrian camel once every two weeks, a total of 5 times, except for the first use Freund's complete adjuvant was used, and Freund's incomplete adjuvant was used for the remaining several times. (2) Three days after the last immunization, the camel peripheral blood lymphocytes were extracted and total RNA was extracted, and the operation was performed according to the instructions of the QIAGEN RNA extraction kit. (3) According to Invitrogen III First strand synthesis system kit instructions, reverse transcribe the extracted RNA into cDNA and use nested PCR to amplify the VHH chain, the first round of PCR:

[0021] Upstream primer: GTCCTGGCTGCTCTTCTACAAGG

[0022] Downstream primer: GGTACGTGCTGTTGAACTGTTCC

[0023] Amplify the fragment between...

Embodiment 2

[0029] Example 2: Nanobody screening process against Nsp4:

[0030] (1) The Nsp4 recombinant protein (10 μg / well) dissolved in 0.01M pH 7.4 PBS was coupled to a NUNC plate, and placed overnight at 4°C, and a negative control was set up at the same time. (2) Add 200 microliters of 2.5% skimmed milk powder the next day, and block at room temperature for 2 hours. (3) After 2 hours, add 100 μl phage (1×10 11pfu immunized camel nanobody phage display gene library) and acted for 1 hour at room temperature. (4) Wash 15 times with PBST (PBS containing 0.05% Tween 20) to wash away unbound phages. (5) Triethylamine (100 mM) was used to elute the phages specifically binding to Nsp4, and infect Escherichia coli TG1 in logarithmic growth phase to produce and purify the phages for the next round of screening. After 3 rounds of screening, positive clones were enriched.

Embodiment 3

[0031] Example 3: Identification of a single positive clone by enzyme-linked immunosorbent assay (ELISA):

[0032] (1) After three rounds of screening, the TG1 cells infected with phage were spread on the LB-AMP agar plate according to a certain dilution ratio, and 96 single clones were randomly picked and inoculated in the TB-AMP medium to grow to the logarithmic phase, Add IPTG at a final concentration of 1 mM, and culture overnight at 37°C. (2) Collect the bacteria, freeze and thaw once at -20°C, and the supernatant should contain nanobody fragments. (3) Add 100 μl of supernatant to ELISA wells coated with Nsp4, and add 100 μl of supernatant to ELISA wells coated with control protein Nsp9 at the same time, and place at room temperature for 1 hour. (4) Wash 5 times with PBST, add Rabbit anti-E tag antibody (polyclonal antibody of rabbit origin, purchased from Nanjing GenScript Company), and let stand at room temperature for 1 hour. (5) Wash 5 times with PBST, add HRP G ant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nano antibody of a PRRS virus non-structural protein Nsp4, and at the same time, discloses an amino acid sequence of the nano antibody and a DNA sequence encoding the nano antibody. The invention also provides a lentiviral vector which can introduce a nano antibody gene into a host cell to play an antiviral function. The Nsp4 nano antibody can be combined specifically with the PRRS virus non-structural protein Nsp4, and has the function of inhibiting the proliferation of the PRRS virus in cells.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a PRRS virus non-structural protein Nsp4 nanobody antibody and its application in anti-virus. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS), also known as PRRS, is an acute infectious disease of pigs caused by PRRS virus infection. The disease has caused huge economic losses to the pig industry in my country, but due to the characteristics of PRRS virus antigen variability, macrophage, antibody-dependent enhancement (ADE) and persistent infection (Chand R J: Pathogenesis of porcine reproductive and respiratory syndrome virus. Curr Opin Virol, 2012, 2(3): 256-263), the protective effect of existing vaccines on this disease is very limited, and there is no specific antiviral drug for this disease at present. [0003] PRRS virus is a single-stranded positive-sense RNA virus with a genome size of about 15 kb, including at least 11 open rea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/10C12N15/13C12N15/867A61K39/42A61P31/14
CPCA61K2039/505C07K16/1045C07K2317/565C07K2317/567C07K2317/569C07K2319/60C12N15/86C12N2740/15043
Inventor 周恩民刘红亮
Owner NORTHWEST A & F UNIV