A kind of nanobody specifically binding prrs virus non-structural protein nsp4 and application thereof
A technology of non-structural proteins and nanobodies, applied in antiviral immunoglobulins, viruses/phages, retroRNA viruses, etc., can solve the problems of no specific antiviral drugs and limited protective effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1: Construction of Nanobody Library against PRRS virus nonstructural protein Nsp4:
[0020] (1) Mix 5ml Nsp4 recombinant protein (1mg / m1) with Freund's adjuvant in equal volume and emulsify evenly, and immunize an Alxa Bactrian camel once every two weeks, a total of 5 times, except for the first use Freund's complete adjuvant was used, and Freund's incomplete adjuvant was used for the remaining several times. (2) Three days after the last immunization, the camel peripheral blood lymphocytes were extracted and total RNA was extracted, and the operation was performed according to the instructions of the QIAGEN RNA extraction kit. (3) According to Invitrogen III First strand synthesis system kit instructions, reverse transcribe the extracted RNA into cDNA and use nested PCR to amplify the VHH chain, the first round of PCR:
[0021] Upstream primer: GTCCTGGCTGCTCTTCTACAAGG
[0022] Downstream primer: GGTACGTGCTGTTGAACTGTTCC
[0023] Amplify the fragment between...
Embodiment 2
[0029] Example 2: Nanobody screening process against Nsp4:
[0030] (1) The Nsp4 recombinant protein (10 μg / well) dissolved in 0.01M pH 7.4 PBS was coupled to a NUNC plate, and placed overnight at 4°C, and a negative control was set up at the same time. (2) Add 200 microliters of 2.5% skimmed milk powder the next day, and block at room temperature for 2 hours. (3) After 2 hours, add 100 μl phage (1×10 11pfu immunized camel nanobody phage display gene library) and acted for 1 hour at room temperature. (4) Wash 15 times with PBST (PBS containing 0.05% Tween 20) to wash away unbound phages. (5) Triethylamine (100 mM) was used to elute the phages specifically binding to Nsp4, and infect Escherichia coli TG1 in logarithmic growth phase to produce and purify the phages for the next round of screening. After 3 rounds of screening, positive clones were enriched.
Embodiment 3
[0031] Example 3: Identification of a single positive clone by enzyme-linked immunosorbent assay (ELISA):
[0032] (1) After three rounds of screening, the TG1 cells infected with phage were spread on the LB-AMP agar plate according to a certain dilution ratio, and 96 single clones were randomly picked and inoculated in the TB-AMP medium to grow to the logarithmic phase, Add IPTG at a final concentration of 1 mM, and culture overnight at 37°C. (2) Collect the bacteria, freeze and thaw once at -20°C, and the supernatant should contain nanobody fragments. (3) Add 100 μl of supernatant to ELISA wells coated with Nsp4, and add 100 μl of supernatant to ELISA wells coated with control protein Nsp9 at the same time, and place at room temperature for 1 hour. (4) Wash 5 times with PBST, add Rabbit anti-E tag antibody (polyclonal antibody of rabbit origin, purchased from Nanjing GenScript Company), and let stand at room temperature for 1 hour. (5) Wash 5 times with PBST, add HRP G ant...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


