A Nucleotide Sequence from Rice Streak Virus to Increase Protein Expression Level
A rice streak virus, nucleotide sequence technology, applied in the direction of virus/phage, DNA/RNA fragments, introduction of foreign genetic material using vectors, etc., can solve the problems of low protein expression level and criticism, and achieve the effect of improving the expression level.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Embodiment 1: Application of the present invention improves the expression level of GFP in plants
[0022] 1. Cloning of sequences
[0023] The total RNA of the rice sample infected with rice stripe virus was extracted by Trizol method, reverse-transcribed into cDNA; using this as template, use P1 (ACACAAAGTCTGGGTAATA) (SEQ NO.1) and P2 (TGTAGCAAGAGGTACTGGA) (SEQ NO.2) primers to carry out PCR reaction. The amplification system was as follows: 5 μl of 10×EX Taq buffer, 5 μl of 2.5mM dNTPs, 2 μl of 10 μM P1 and P2, 1 μl of EX Taq enzyme (5U / μl) (purchased from Dalian Takara Company), and 50 μl of sterile water. The reaction conditions were pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; extension at 72°C for 10 min. The target PCR product size is 92bp (sequence is as follows: acacaaagtc tgggtaataa aattttcgat tttgctttta cattccaaatttcatctaag ccgcaaccat tcctccagta cctcttgcta ca) (S...
Embodiment 2
[0030] Embodiment 2: Application of the present invention improves the expression level of RSV CP in plants
[0031] In order to further verify the expression-promoting effect of the sequence of the present invention, another coding protein RSV CP was used for the same verification.
[0032] 1. Cloning of sequences
[0033] The sequence was obtained according to the method of implementation 1.
[0034] 2. Sequence fusion with RSV-CP
[0035] According to the sequence measured by UTR, primer P3 was designed ( TCTAGA ACACAAAGTCTGGGTAATA, the underline is the Xba I recognition site) and P7 (TGGCTTGTTGGTGCCCATTG TAGCAAGAGGTACTGG) (SEQ NO.7), the T-UTR vector was used as a template for PCR reaction. The amplification system was as follows: 5 μl of 10×Ex Taq buffer, 5 μl of 2.5mM dNTPs, 2 μl of 10 μM P3 and P4, 1 μl of Ex Taq enzyme (5U / μl) (purchased from Dalian Takara Company), and 50 μl of sterile water. The reaction conditions were pre-denaturation at 94°C for 3 min; dena...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


