Unlock instant, AI-driven research and patent intelligence for your innovation.

A Nucleotide Sequence from Rice Streak Virus to Increase Protein Expression Level

A rice streak virus, nucleotide sequence technology, applied in the direction of virus/phage, DNA/RNA fragments, introduction of foreign genetic material using vectors, etc., can solve the problems of low protein expression level and criticism, and achieve the effect of improving the expression level.

Active Publication Date: 2020-01-14
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] The transient expression system of plants is a relatively safe and rapid expression system for exogenous proteins, but its low protein expression level is widely criticized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Nucleotide Sequence from Rice Streak Virus to Increase Protein Expression Level
  • A Nucleotide Sequence from Rice Streak Virus to Increase Protein Expression Level
  • A Nucleotide Sequence from Rice Streak Virus to Increase Protein Expression Level

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1: Application of the present invention improves the expression level of GFP in plants

[0022] 1. Cloning of sequences

[0023] The total RNA of the rice sample infected with rice stripe virus was extracted by Trizol method, reverse-transcribed into cDNA; using this as template, use P1 (ACACAAAGTCTGGGTAATA) (SEQ NO.1) and P2 (TGTAGCAAGAGGTACTGGA) (SEQ NO.2) primers to carry out PCR reaction. The amplification system was as follows: 5 μl of 10×EX Taq buffer, 5 μl of 2.5mM dNTPs, 2 μl of 10 μM P1 and P2, 1 μl of EX Taq enzyme (5U / μl) (purchased from Dalian Takara Company), and 50 μl of sterile water. The reaction conditions were pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; extension at 72°C for 10 min. The target PCR product size is 92bp (sequence is as follows: acacaaagtc tgggtaataa aattttcgat tttgctttta cattccaaatttcatctaag ccgcaaccat tcctccagta cctcttgcta ca) (S...

Embodiment 2

[0030] Embodiment 2: Application of the present invention improves the expression level of RSV CP in plants

[0031] In order to further verify the expression-promoting effect of the sequence of the present invention, another coding protein RSV CP was used for the same verification.

[0032] 1. Cloning of sequences

[0033] The sequence was obtained according to the method of implementation 1.

[0034] 2. Sequence fusion with RSV-CP

[0035] According to the sequence measured by UTR, primer P3 was designed ( TCTAGA ACACAAAGTCTGGGTAATA, the underline is the Xba I recognition site) and P7 (TGGCTTGTTGGTGCCCATTG TAGCAAGAGGTACTGG) (SEQ NO.7), the T-UTR vector was used as a template for PCR reaction. The amplification system was as follows: 5 μl of 10×Ex Taq buffer, 5 μl of 2.5mM dNTPs, 2 μl of 10 μM P3 and P4, 1 μl of Ex Taq enzyme (5U / μl) (purchased from Dalian Takara Company), and 50 μl of sterile water. The reaction conditions were pre-denaturation at 94°C for 3 min; dena...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleotide sequence. The nucleotide sequence is connected to the upstream of a gene encoding region and then performs the expression process of a conventional exogenous gene in a plant body. Preferably, the nucleotide sequence is connected to the upstream of an initiation codon of an exogenous gene encoding region. Therefore, the expression level of the exogenous gene in the plant body can be greatly improved.

Description

technical field [0001] The invention relates to the field of biotechnology and is used for improving the expression level of exogenous genes in plants. Background technique [0002] The transient expression system of plants is a relatively safe and rapid exogenous protein expression system, but its low protein expression level has been widely criticized. A large number of studies have shown that the 5'UTR of genes plays an important role in the regulation of genes. The mRNA 5′UTR can affect the translation level of genes by regulating the translation initiation process. It has been confirmed by experiments that the leader sequence of tobacco mosaic virus, namely 5'UTR, acts as a protein translation enhancer to greatly increase the protein translation level in an in vitro expression system. In addition, 5'UTR is also involved in mRNA stability, folding, nuclear transport interaction, RNA processing, shearing and translation machinery, and intracellular transport and localiz...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/113A01H5/00A01H6/82
CPCC07K14/43595C12N15/113C12N15/8216C12N2310/10C12N2840/105C12N2840/60
Inventor 燕飞韩科雷郑红英鲁宇文彭杰军林林赵晋平程晔陈剑平
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES