Unlock instant, AI-driven research and patent intelligence for your innovation.

B.melitensis Delta UGPase and construction method thereof

A Brucella molecular marker technology, applied in the research field of Brucella novel molecular marker vaccine, achieves good safety and immunogenicity

Inactive Publication Date: 2016-12-07
INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, scholars' research on the molecularly-marked vaccine strains of Brucella is still in the stage of laboratory research, and multiple molecularly-marked Brucella strains are obtained through modification on the basis of attenuated vaccine strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • B.melitensis Delta UGPase and construction method thereof
  • B.melitensis Delta UGPase and construction method thereof
  • B.melitensis Delta UGPase and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Construction of embodiment 1 Brucella UGPase gene deletion strain (B.melitensis △ UGPase)

[0042] 1. Primer design

[0043] Primers were designed using Primer 5.0 software based on the upstream and downstream fragments of the UGPase gene, sacB gene fragment, UGPase gene fragment, and pBK-CMV vector of the virulent strain of Brucella 16M (B.melitensis 16M). , PCR amplification of the upper and lower homology arm sequences of the Brucella UGPase gene. The designed primers are shown in Table 1.

[0044] Table 1

[0045] Primer name

Primer sequence (5'-3')

UGPaseF1

GGATCCCTGGAGCCACTGCCCCCATTTG

UGPaseR1

CTCGAGTCCTCTCCTCGATTTTCATTCA

UGPaseF2

CTCGAGTAATCGGGCTATCCAATATCGC

UGPaseR2

TCTAGACCACAGTGAATGCGGAAACCAG

sacBF

GTCGACACTCAGTACATAATAAAGGAGACAT

sacBR

GGATCCTGGGATTCACCTTTATGTTGATAAG

UGPase 1

ATGAGTTCTATTCGGAAAATCCGC

UGPase 2

TCAGGCTGGCTGGATCGTCT

[0046] In Table 1, UG...

Embodiment 2

[0059] Example 2 Analysis of survival-related phenotypes in Brucella UGPase gene deletion strain (B.melitensis△UGPase)

[0060] 1. Cell adhesion and invasion assay

[0061] Mouse macrophage RAW264.7 was cultured, wild type Brucella virulent strain 16M (B.melitensis16M), Brucella UGPase gene deletion strain (B.melitensis△UGPase) and Brucella vaccine strain M5( B. melitensis M5) infected cells with 200:1 MOI (multiplicity of infection), then co-incubated in 5% CO2, 37°C environment for 5min, 10min, 15min, 30min, 45min, 60min, rinsed with PBS 3 times, washed away Unadhered bacteria in the culture medium were then incubated in a medium containing 100 mg / ml ampicillin for 60 minutes to kill extracellular bacteria, rinsed with PBS 3 times, and lysed with 0.1% (V / V) Triton x-100 , to release the intracellular bacteria, the lysate was diluted in multiples (the specific dilution multiples are: 101, 102, 103, 104, 105, 106) and then spread on the TSA plate, and the CFU was calculated t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a B.melitensis Delta UGPase and a construction method thereof and belongs to the field of novel Brucella molecular marker vaccine research. The preservation number of the B.melitensis Delta UGPase is CGMCC No.11908, and a Brucella virulent strain M16 and UDP-glucose pyrophosphorylase (UGPase) gene related to virulence are lost. Upstream and downstream homologous arm sequences of the UGPase gene are amplified by PCR to obtain two gene segments, the gene segments and suicide carrier vector pBK-CMV-SacB are connected to pBK-CMV-SacB UGPase gene-NC losing mutation carriers after fusion and double enzyme digestion, the mixture is electro-transformed to Brucella for screening culture, and the B.melitensis Delta UGPase is finally obtained. The vaccine strain can be taken as a novel brucellosis vaccine candidate bacterial strain for controlling brucellosis spreading, and a basis is laid for novel Brucella vaccine development.

Description

technical field [0001] The invention belongs to the technical field of research on novel molecular marker vaccines of Brucella, and in particular relates to a strain of Brucella molecular marker deletion and a construction method thereof. Background technique [0002] Brucellosis (brucellosis, referred to as brucellosis) is a zoonotic infectious disease caused by Brucella (Brucella). There are 7 species of Brucella, and 5 species mainly infect humans: cattle, sheep, pigs, dogs and marine animals. Brucella is a Gram-negative bacterium that mainly causes undulating fever and chronic infection in humans as well as infertility and abortion in ruminants. [0003] The current effective measures for the prevention and control of brucellosis in my country is to screen negative animals for vaccine immunization through serological testing. However, the antibodies produced after the existing vaccine immunization are indistinguishable from those of naturally infected animals, that is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N15/74C12R1/01
CPCC12N9/1241C12N15/74C12N2800/101C12Y207/07009
Inventor 杨艳玲王兴龙钱晶卜昭阳郭利李春义
Owner INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS