Molecular marker using Wnt5a gene as pig litter size character related detection

A technology of molecular markers and litter size, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of implantation failure, serious fertility problems, etc.

Active Publication Date: 2017-02-22
HUAZHONG AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Non-attached vesicles were seen in the uterus of Wnt5a-knockout and Wnt5a-overexpressing mice, both of which had engraftment failure and severe fertility problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker using Wnt5a gene as pig litter size character related detection
  • Molecular marker using Wnt5a gene as pig litter size character related detection
  • Molecular marker using Wnt5a gene as pig litter size character related detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Cloning of embodiment 1 Wnt5a gene

[0026] (1) Primer design

[0027] Use the 3'UTR sequence of the pig Wnt5a gene provided in NCBI as a reference sequence to design primers for PCR amplification. The nucleotide sequence of the primer pair is as follows:

[0028] Wnt5a: forward primer: 5′-ATCACACCCTGAGTGTCACG-3′

[0029] Reverse primer: 5′-TGTGGAAAGAGGTGTCCTGG-3′

[0030] (2) Cloning and sequencing of PCR products

[0031] The purified PCR product was connected to the pMD-18T vector (purchased from Treasure Bioengineering Dalian Co., Ltd.) overnight at 4°C in a water bath; under sterile conditions, 100-120 μl of competent cells were placed in a 1.5ml Ependorff tube, and 5 μl of The ligation product was added and mixed, placed on ice for 30 minutes, heat-shocked at 42°C for 90s, ice-bathed for 3-4 minutes, added 400 μl LB liquid medium without antibiotics, and incubated at 37°C for 45 minutes with shaking. Take 100 μl of the above LB and spread it on the agar plate ...

Embodiment 2

[0032] Example 2 The SNP of the 3'UTR of Wnt5a gene significantly affects the binding efficiency of miR-628-5p to the target gene

[0033] 1. Construction of Wnt5a gene 3′UTR-psiCHECK-2 dual luciferase reporter vector

[0034] (1) Recover and purify the amplified target fragment.

[0035] (2) Take the preserved 100μL containing psi-CHECK TM-2 Carrier bacterial solution was added to 5 mL of LB medium containing ampicillin, expanded for 12 hours, and plasmid DNA was extracted from the expanded cultured bacterial solution with the plasmid mini-extraction kit produced by Tiangen Biological (Beijing) Technology Company According to the instructions, the concentration of the recovered plasmid was measured with a NanoDrop spectrophotometer (Thermo).

[0036] (3) Use restriction endonucleases Xho I (Fermenters, ER0691) and Not I (Fermenters, ER0691) to simultaneously double digest the target fragment and the vector. The vector and the target fragment were ligated with T4 DNA ligase...

Embodiment 3

[0043] Embodiment 3 Establishment of PCR-RFLP diagnostic method

[0044] By analyzing the SNP site of the 366bp sequence (Example 1) obtained by the above clone, it was found that there was no suitable endonuclease to carry out enzyme digestion and typing verification on the SNP site, so the mutant primers were redesigned to amplify, and the mutant primers were amplified to obtain The sequence of BcgI endonuclease can be used for restriction type verification, the specific steps are as follows:

[0045] (1) Primer sequence:

[0046] Forward primer: 5'-GCACACGTGGGTTTGAAGAG-3'

[0047] Reverse primer: 5'- TTTAATATAA CACTGCAAAATGAAGGCGAGAG

[0048] Using the primers in the above step (1) to amplify to obtain a sequence with a length of 185bp, corresponding to SEQ ID NO: 6 in the sequence table, this sequence is the sequence used by the applicant for enzyme digestion and typing with BcgI enzyme. The complete sequence information is as follows:

[0049] GCACACGTGGGTTTGAAGAGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of pig molecular markers screening, and particularly relates to a molecular marker using a Wnt5a gene as pig litter size character related detection. The molecular marker is obtained by cloning from the pig WNT5A gene. The basic group at the 213 site of a nucleotide sequence as shown in the SEQ ID NO: 1 has an A / G allele mutation, and the mutation causes the BcgI-RFLP polymorphism. The invention further discloses a screening method of the molecular marker and the application thereof in the pig assistant selection.

Description

technical field [0001] The invention belongs to the technical field of porcine molecular marker screening, and in particular relates to Wnt5a gene as a molecular marker for the detection of pig litter size traits. The molecular marker is cloned from the pig WNT5A gene, and the invention also includes a detection method and application of the 3'UTR sequence mutation site of the pig WNT5A gene. Background technique [0002] The litter size of sows is an important indicator of pig reproductive traits and an important factor affecting the economic benefits of pig farming. Embryo implantation in early pregnancy is a critical step in pigs because of high embryo mortality during this process (Park et al., 2000), which is an important reason for the decline in litter size (Geisert et al., 2002). Therefore, research and The genes related to pig early embryo implantation are of great significance for the genetic improvement of pig litter size. [0003] The interplay between uterine ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6888C12Q2600/124C12Q2600/156C12Q2521/301
Inventor余梅王敏邓大栋刘榜李小平李新云朱猛进赵书红
OwnerHUAZHONG AGRI UNIV