Method for obtaining pigeon magnetic-sensing protein by using prokaryotic expression system

A prokaryotic expression and pigeon technology, applied in the field of genetic engineering, can solve the problems of easy protein degradation, prosthetic group falling off, low expression level, etc., and achieve the effect of low technical complexity, low cost and low expression level

Inactive Publication Date: 2017-03-08
NAT UNIV OF DEFENSE TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Our laboratory also used the insect baculovirus expression system to successfully obtain the active protein of pigeon Columbia livia Cryptochrome 1 (ClCry1), but in the experiment, we also found that there are many problems in this expression. First, the operation is cumbersome and costly. Low amount, protein is easy to degrade, prosthetic group is easy to fall off

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining pigeon magnetic-sensing protein by using prokaryotic expression system
  • Method for obtaining pigeon magnetic-sensing protein by using prokaryotic expression system
  • Method for obtaining pigeon magnetic-sensing protein by using prokaryotic expression system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] 1. Obtain the target gene sequence:

[0058] Use the pFastBac HT A vector containing the ClCry1 gene sequence already in the laboratory as a template (for the map of the pFastBac HT A vector, see figure 1 ), design primers with Hind III and BamH I as restriction sites, and use PCR to obtain the target gene sequence from the pFast HTA vector.

[0059] The ClCry1 gene sequence connected to the pFastBac HT A vector is as follows:

[0060] ATGGGGGTGAACGCCGTGCACTGGTTCCGCAAGGGGCTGCGGCTCCACGACAACCCGGCGCTGCGGGAGTGCATCCAGGGCGCCGACACGGTCCGCTGCGTCTACATCCTGGACCCCTGGTTCGCCGGCTCTTCCAACGTGGGCATCAACAGGTGGCGATTCCTGCTTCAATGTCTTGAGGATCTTGATGCCAATCTACGGAAACTGAATTCACGTTTGTTTGTTATTCGTGGACAGCCAGCAGATGTTTTCCCCAGACTTTTTAAGGAATGGAATATTACAAAACTTTCTATTGAATATGATTCTGAACCATTCGGGAAGGAAAGAGATGCAGCGATTAAGAAGTTGGCTAGTGAAGCTGGAGTGGAGGTCATTGTTCGAATTTCCCACACATTATATGACCTAGACAAAATAATAGAATTAAATGGAGGACAACCTCCTCTTACTTACAAGCGATACCAGACCCTAATTAGCAGAATGGAGCCACTAGAGATGCCAGTGGAGACTATAACCCCAGAAGTAATGGAAAAATGTACTACTCCAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for obtaining pigeon magnetic-sensing protein by using a prokaryotic expression system. The method comprises: extracting a target gene containing ClCry1; treating the gene the target gene fragment and a vector through double digestion; linking the obtained target gene to the vector to obtain a recombinant vector; transforming the recombinant vector into competent cells, and screening positive clones; and culturing the positive clones, carrying out protein expression, and purifying to obtain the pigeon magnetic-sensing protein. According to the present invention, with the method, the pigeon magnetic-sensing protein ClCry1 can be simply, rapidly and efficiently expressed in a low cost manner.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for obtaining pigeon magnetosensitive protein by using a prokaryotic expression system. Background technique [0002] Biogeomagnetic navigation generally exists in the biological world. Birds such as pigeons, garden warblers, and robins, and other creatures such as sea turtles, brown bats, Caribbean spiny lobsters, red lizards, and even insects such as fruit flies are also geomagnetically sensitive. At present, a lot of research has been done on bio-geomagnetic navigation at home and abroad, mainly focusing on animal behavior and theoretical simulation calculations. There have been many studies on its specific biological and physiological mechanisms, and some hypotheses and explanations have been put forward, but there are still many unclear aspects and no good consensus has been reached. [0003] Cryptochrome (Cry) protein is considered to be the most like...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/465C12N15/70
CPCC07K14/465
Inventor王璟袁晓霞王雪峰吴文健
OwnerNAT UNIV OF DEFENSE TECH