Unlock instant, AI-driven research and patent intelligence for your innovation.

LAMP (loop-mediated isothermal amplification) primer group and method for detecting transgenic ingredient CaMv35S

A primer set, camv-f3 technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial assay/inspection, etc., can solve the problems of high detection cost, cumbersome detection operation, high investment, etc. Avoid false positives and reduce investment

Inactive Publication Date: 2017-03-08
XUCHANG UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The second technical problem to be solved by the present invention is that the method for detecting the CaMV35S promoter in the prior art needs to invest in expensive instruments, the detection operation is cumbersome, and the detection cost is high, so as to provide a simple operation and low detection cost. Method for detecting CaMV35S promoter

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Design of LAMP primer set for detection of CaMV35S promoter

[0022] In this embodiment, the LAMP primer set for detecting the CaMV35S promoter includes the LAMP primer set including CaMV-F3 primers, CaMV-B3 primers, CaMV-FIP primers, CaMV-BIP primers, CaMV-LF primers, and CaMV-LB primers; Wherein, the CaMV-F3 primer has a sequence structure as shown in SEQ ID No.1; the CaMV-B3 primer has a sequence structure as shown in SEQ ID No.2; the CaMV-FIP primer has a sequence structure as shown in SEQ ID No.2; The sequence structure shown in No.3; the CaMV-BIP primer has the sequence structure shown in SEQ ID No.4; the CaMV-LF primer has the sequence structure shown in SEQ ID No.5; the CaMV - The LB primer has a sequence structure as shown in SEQ ID No.6.

[0023] Said SEQ ID No.1: 5`-GGCTCCTACAAATGCCATCA-3`

[0024] Said SEQ ID No.2: 5`-GATAGTGGGATTGTGCGTCA-3`

[0025] The SEQ ID No.3: 5`-GGTGGGGGTCCATCTTTGGGTTTTAGGAAAGGCCATCGTTGAA-3`

[0026] The SEQ ID No.4: 5`...

Embodiment 2

[0029] Example 2 Detection of the CaMV35S promoter of the LAMP primer set

[0030]The positive control solution of the transgenic component CaMV35S promoter used in this example was purchased from General Biosystems (Anhui) Co., Ltd., and the gene fragment of the CaMV35S promoter has a sequence structure as shown in SEQ ID No.7, and the SEQ ID No.7 is GCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATC; the DNA extraction kit was purchased from Bioengineering (Shanghai) Co., Ltd. It should be noted that not only the positive control solution of the CaMV35S promoter and the DNA extraction kit are commercially available conventional materials disclosed in the prior art, but the Bst DNA polymerase and deoxyribonucleoside triphosphate used in this example , Bst DNA polymerase buffer, betaine, MgSO 4 , deionized water, 4-(2-pyridylazo)reso...

Embodiment 3

[0038] Example 3 Detection of CaMV35S promoter by LAMP primer set

[0039] The LAMP primer set described in Example 1 is used to detect the CaMV35S promoter, and the specific steps are as follows:

[0040] Take 1 µl of the CaMV-F3 primer at a concentration of 10 µM, 1 µl of the CaMV-B3 primer at a concentration of 10 µM, 1 µl of the CaMV-FIP primer at a concentration of 40 µM, 1 µl of the CaMV-BIP at a concentration of 40 µM, and 1 µl of the CaMV-BIP at a concentration of 40 µM. 20µM of the CaMV-LF primer, 1µl of 20µM CaMV-LB primer, 5µl of 5M betaine (English name betaine), 3µl of 150mM deoxyribonucleoside triphosphate (dNTP for short), 0.5 µl of 100mM MgSO 4 , 2.5µl concentration of 10× Bst DNA polymerase buffer (English name Bst DNA Polymerase Buffer), 1µl concentration of 8U / µl BstDNA polymerase (English name Bst DNA Polymerase), 5µl deionized water, and 2µl The positive control solution and the negative control solution described in Example 2 were mixed, the two groups ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an LAMP (loop-mediated isothermal amplification) primer group for detecting CaMV35S starter, comprising CaMV-F3primer, CaMV-B3 primer, CaMV-FIP primer, CaMV-BIP primer, CaMV-LF primer, and CaMV-LB primer. The invention also provides a method for detecting CaMv35S starter by using the above LAMP primer group. The LAMP primer group provided herein can detect CaMV35S starter, a detection apparatus is simple, input of expensive PCR apparatus is not required, the results are easy to determine, lab input is lowered, and the LAMP primer group and the method are suitable for popularization and application.

Description

technical field [0001] The invention belongs to the technical field of biomolecular detection, and in particular relates to a LAMP primer set and a method for detecting transgenic component CaMV35S. Background technique [0002] With the rapid development of genetically modified technology, the industrialization speed of global agricultural biotechnology has also been greatly accelerated, and the promotion and planting area of ​​genetically modified crops has been increasing year by year. A cautious attitude is generally adopted in this regard, and a series of regulations have been introduced to restrict the trade of genetically modified products, requiring the labeling of genetically modified crops and their processed products. Therefore, it is particularly important to establish a sound genetically modified agricultural product and food testing system. [0003] CaMV35S is a common regulatory element for exogenous gene expression in plants and can be used as a marker for t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q1/6844C12Q2531/119C12Q2521/101
Inventor 王德国王永真郭孝辉肖付刚张永清郭卫芸
Owner XUCHANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More