GAD gene for increasing stress tolerance of lactic acid bacteria and application thereof

A lactic acid bacteria, stress-tolerant technology, applied in application, genetic engineering, plant genetic improvement and other directions, to achieve the effect of improving survival rate, improving low temperature stress tolerance and acid stress tolerance

Active Publication Date: 2017-03-22
ANHUI AGRICULTURAL UNIVERSITY
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, it can improve the ability of lactic acid bacteria to resist acid stress by regulating amino acid metabolism; improve the resistance of lactic acid bacteria by regulating the composition of fatty acids on the cell membrane and then regulate the physiological functions of cell membrane and cell wall; improve the resistance o

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GAD gene for increasing stress tolerance of lactic acid bacteria and application thereof
  • GAD gene for increasing stress tolerance of lactic acid bacteria and application thereof
  • GAD gene for increasing stress tolerance of lactic acid bacteria and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0027] The technical solutions of the present invention will be further explained below through specific implementations in conjunction with the drawings.

[0028] 1. Construction of recombinant expression strain:

[0029] Amplify the CsGAD gene sequence cloned by the inventors from tea leaves in the early stage, and connect it to the expression vector pNZ8148 of Lactococcus lactis to obtain the recombinant plasmid pNZ8148-CsGAD, and then electrotransform it into the host bacteria L.lactisNZ9000, The recombinant strain L.lactis NZ9000-CsGAD was obtained (the lactic acid bacteria L.lactisNZ9000 and the expression plasmid vector pNZ8048 were purchased from Hunan Changsha Yingrun Biotechnology Co., Ltd.). The detailed steps are as follows:

[0030] (1) According to the obtained tea tree GAD gene sequence, the sequence is as shown in SEQ ID NO. 1. Use Primer 5.0 software to design a pair of primers at the 5'and 3'of the sequence:

[0031] CsGAD-up CCG CCATGG ATGGTTCTCTCAAAGATTGC NcoI r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a GAD (Glutamic Acid Decarboxylase) gene for increasing stress tolerance of lactic acid bacteria. The GAD gene is characterized in that a gene sequence is shown as SEQ ID NO.1. The gene can be used for increasing the cold stress resistance and acid stress resistance of the lactic acid bacteria. A method comprises the following steps: introducing a recombinant plasmid containing the GAD gene into the lactic acid bacteria and excessively expressing the glutamic acid decarboxylase CsGAD for compounding gamma-aminobutyric acid in lactic acid bacteria, thereby increasing the cold stress resistance and acid stress resistance of the lactic acid bacteria. Thus, the survival rate of the lactococcus lactis under low-temperature and acid environments can be increased, the GAD gene can be used for developing and applying various healthcare foods and an excellent guarantee can be supplied for the industrial production.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a gene for improving the stress-resistant performance of lactic acid bacteria by using genetic engineering technology to express GABA endogenously and its application. Background technique [0002] Lactic acid bacteria (LAB) is a general term for a group of Gram-positive bacteria with different morphology, metabolic properties and physiological characteristics. Lactic acid bacteria are commonly found in the intestines of humans and animals, and are unanimously recognized as safe microorganisms. [0003] Lactic acid bacteria can inhibit the adhesion, colonization and invasion of intestinal epithelial cells by pathogenic microorganisms, and the metabolites of lactic acid bacteria can also prevent pathogenic microorganisms from invading the biological barrier. Because lactic acid bacteria have good probiotic effects on animals, plants and human body, lactic acid ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/60C12N9/88C12N1/21C12P13/00
Inventor 陈琪赵颖伍赟付瑞燕梅林宛晓春
Owner ANHUI AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap