GAD gene for increasing stress tolerance of lactic acid bacteria and application thereof

A lactic acid bacteria, stress-tolerant technology, applied in application, genetic engineering, plant genetic improvement and other directions, to achieve the effect of improving survival rate, improving low temperature stress tolerance and acid stress tolerance

Active Publication Date: 2017-03-22

ANHUI AGRICULTURAL UNIVERSITY

2 Cites 11 Cited by

AI-Extracted Technical Summary

Problems solved by technology

For example, it can improve the ability of lactic acid bacteria to resist acid stress by regulating amino acid metabolism; improve the resistance of lactic acid bacteria by regulating the composition of fatty acids on the cell membrane and then regulate the physiological functions of cell membrane and cell wall; improve the resistance o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Method used

Low-temperature stress experiment result shows, is cultivated to the lactic acid bacteria antifreeze ability of stable early stage and is better than logarithmic phase mid-term and two cultivation stages of stable late stage, and its surviving bacteria number is much higher than other two stages (see Fig. 2,3 ,4), but no matter at which stage of culture, whether it was under 4°C refrigeration or -20°C freezing stress, the survival number of recombinant bacteria was much higher than that of control bacteria by several orders of magnitude, indicating that by expressing in L.lactis NZ9000 The CsGAD protein method can significantly impro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Abstract

The invention discloses a GAD (Glutamic Acid Decarboxylase) gene for increasing stress tolerance of lactic acid bacteria. The GAD gene is characterized in that a gene sequence is shown as SEQ ID NO.1. The gene can be used for increasing the cold stress resistance and acid stress resistance of the lactic acid bacteria. A method comprises the following steps: introducing a recombinant plasmid containing the GAD gene into the lactic acid bacteria and excessively expressing the glutamic acid decarboxylase CsGAD for compounding gamma-aminobutyric acid in lactic acid bacteria, thereby increasing the cold stress resistance and acid stress resistance of the lactic acid bacteria. Thus, the survival rate of the lactococcus lactis under low-temperature and acid environments can be increased, the GAD gene can be used for developing and applying various healthcare foods and an excellent guarantee can be supplied for the industrial production.

Application Domain

BacteriaGenetic engineering +3

Technology Topic

Increased stress tolerancePlasmid +10

Image

Examples

Experimental program(1)
Effect test(1)

Example Embodiment

[0027] The technical solutions of the present invention will be further explained below through specific implementations in conjunction with the drawings.

[0028] 1. Construction of recombinant expression strain:

[0029] Amplify the CsGAD gene sequence cloned by the inventors from tea leaves in the early stage, and connect it to the expression vector pNZ8148 of Lactococcus lactis to obtain the recombinant plasmid pNZ8148-CsGAD, and then electrotransform it into the host bacteria L.lactisNZ9000, The recombinant strain L.lactis NZ9000-CsGAD was obtained (the lactic acid bacteria L.lactisNZ9000 and the expression plasmid vector pNZ8048 were purchased from Hunan Changsha Yingrun Biotechnology Co., Ltd.). The detailed steps are as follows:

[0030] (1) According to the obtained tea tree GAD gene sequence, the sequence is as shown in SEQ ID NO. 1. Use Primer 5.0 software to design a pair of primers at the 5'and 3'of the sequence:

[0031] CsGAD-up CCG CCATGG ATGGTTCTCTCAAAGATTGC NcoI restriction site

[0032] CsGAD-down CCC AAGCTT CTAGCAAATCACTTGTGT HindIII restriction site

[0033] Use high-fidelity enzymes to carry out PCR amplification from the extracted tea tree leaf cDNA, purify and recover the resulting PCR products, and use ordinary Taq enzyme to add "A" reaction (conventional operation) and then recover and ligate into the cloning vector pMD19- T, the pMD19-CsGAD plasmid was constructed and transformed into E. coli Trans1-T1 competent cells, and the positive clones were picked and sequenced after being cultured overnight on the ampicillin plate.

[0034] (2) After confirming that the sequencing result is correct with the original sequence, the extracted high-concentration pMD19-CsGAD plasmid and pNZ8148 plasmid (commercial empty expression vector) were digested with NcoI and HindIII enzymes, and the digested product was recovered and ligated with T4 Enzyme ligation reaction was performed to obtain pNZ8148-CsGAD expression vector, which was transformed into E. coli Trans1-T1 competent cells again, and the bacteria were selected for sequencing overnight after culture.

[0035] (3) After the sequencing confirmed that the results were correct, the pNZ8148-CsGAD plasmid was extracted by shaking bacteria, transferred into Lactococcus lactis NZ9000 competent cells using an electroporator, cultured at 30°C, and positive clones were picked for colony PCR and plasmid double digestion verification. The correct size of the fragments detected by electrophoresis showed that the recombinant lactic acid bacteria L.lactis NZ-CsGAD was obtained.

[0036] 2. Induced expression and detection of PNZ8048-CsGAD

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

Classification and recommendation of technical efficacy words

Improve survival rate

GAD gene for increasing stress tolerance of lactic acid bacteria and application thereof

A lactic acid bacteria, stress-tolerant technology, applied in application, genetic engineering, plant genetic improvement and other directions, to achieve the effect of improving survival rate, improving low temperature stress tolerance and acid stress tolerance

AI-Extracted Technical Summary

Problems solved by technology

Method used

Abstract

Image

Examples

Example Embodiment

PUM

Description & Claims & Application Information

Similar technology patents

Nursery stock grafting machine

Method for growing seedlings of oil palm seeds

Litopenaeus vannamei water-free keep-alive transporting method

Growing seedlings method for oil-tea sprout with grafting container cup

Cherry grafting method

Classification and recommendation of technical efficacy words

Seedling planting method in alkaline land

Big-tree transplantation method

Method for indoors artificial intensive culture of clamworm

Medical Material and Process for Producing the Same

Green branch cuttage breeding method for indigo fruit honeysuckle