Method for identifying two kinds of collichthys lucidus juvenile fish by using specific primer group

Abstract

The invention relates to the field of molecular marker identification, and concretely discloses a method for identifying two kinds of collichthys lucidus juvenile fish by using a specific primer group. The two kinds of collichthys lucidus juvenile fish are respectively collichthys niveatus juvenile fish and light maigre juvenile fish; the specific primer group consists of a forward primer of L14734: AACCACCGTTGTTATTCAACT, and reverse primers of Cytb: CTCAGAATGACATTTGTCCTCA and Cytb-R: GTTGCGGCCGCGACAATAAAG. The specific primer group is used for performing PCR (Polymerase Chain Reaction) amplification on genome DNA (Deoxyribonucleic Acid) of collichthys niveatus and light maigre and performing electrophoresis detection; an electrophoresis detection spectrogram shows that a PCR amplification product of the collichthys niveatus only generates one specific bright strip in a position near 500bp; and a PCR amplification product of the light maigre generates one specific bright strip respectively in a position near 360bp and a position near 500bp, so that the two kinds of juvenile fish can be accurately, fast and conveniently distinguished.

Description

technical field [0001] The invention relates to the field of molecular marker identification, and in particular relates to a method for identifying juveniles of black gill maidenhair fish and juvenile thorn-headed maidenhair fish by using a specific amplification primer set. Background technique [0002] The black gill plum fish and the thorn head plum child belong to the plum fish genus under the Totototo family, and are important small economic fish in my country. The adult individuals of the thorn-headed plum fish are generally 9 to 14 cm in length and 15 to 50 g in weight, while the adults of the black gill plume are generally 7.5 to 9.5 cm in length and 9 to 20 g in weight. The fish have dark black patches on the gill cavity, while the spiny-headed plumbago does not, so it is easy to distinguish the adult individual of the black-gill plumbago from the spiny plumbago by the external morphology, but the two plums are in the juvenile stage. are very similar in appearance ...

AI Technical Summary

Problems solved by technology

[0005] In view of the fact that it is impossible to distinguish juvenile black gill scallops from juvenile spiny scallops by external morphology, and the use of the primer set described in the above patent for genomic DNA amplification cannot accurately and effectively distinguish the juveniles of the two types of scallops Problem, the object of the present invention is to provide a specific primer set and use the specific primer set to identify the juvenile fish of two kinds of plum boy through a suitable PCR amplification route

Images