Application and related medicines of DKK3 gene
A technology of gene and gene interference, applied in drug combination, gene therapy, genetic engineering, etc., can solve problems such as muscle atrophy that cannot be treated
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Example 1 Preparation of adenovirus for DKK3 gene RNAi
[0068] 1. Screening for effective siRNA targets against the DKK3 gene
[0069] Obtain the mRNA sequence (NM_015814) of DKK3 from NCBI query, as follows:
[0070]
[0071]
[0072] By using software, design siDKK3 that specifically knocks down the expression of DKK3 protein, the sequence is as follows:
[0073] sense(5'-3')CCAGGAAGUUCACAAGAUAUU; (SEQ ID NO.1)
[0074] antisense (5'-3') UAUCUUGUGAACUUCCUGGUU (SEQ ID NO. 2).
[0075] Synthesize shRNADKK3 with this pair of siRNA sequences, the sequence is as follows:
[0076] TCGACCAGGAAGTTCACAAGATACTCGAGTATCTTGTGAACTTCCTGGTTTTT; (SEQ ID NO. 3)
[0077] AATTAAAAACCAGGAAGTTCACAAGATACTCGAGTATCTTGTGAACTTCCTGG (SEQ ID NO. 4).
[0078] Two-stage oligo, annealed according to the following system:
[0079] 10x annealing buffer 1ul; 100um oligo f: 4.5ul; 100um oligo r: 4.5ul; 95°C for 5min.
[0080] After cooling down to room temperature automatically, it was dig...
Embodiment 2
[0084] Example 2 Application of Knocking Down Muscle Atrophy Related Marker DKK3 to Treat Muscle Atrophy Caused by Aging
[0085] After the adenovirus interfering with Dkk3 was obtained in Example 1, the titer was 1.3x10 7 Tu / ml. The control group was adenovirus expressing GFP with a titer of 1.3x10 7 Tu / ml. Take 20-month-old C57 / BL wild-type mice, inject GFP virus into TA of left leg, and inject DKK3 interference virus into TA of right leg. 50 μl each time, after continuous injection for 7 days, they were fed for another 7 days. Use the muscle tension tester to test the tonic muscle tension of the TA muscles of the two legs. After the test, the TA was taken out, and half of the OCT was taken for embedding, which was quickly frozen in liquid nitrogen and used as a frozen section. Add 1ml TriZol to the other half, add 200μl chloroform, shake and mix well, centrifuge at 12,000 rpm at 4°C for 15 minutes, take the clear liquid from the upper layer, and transfer it to a new EP...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


