Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Use of dkk3 gene and related drugs

A technology of drugs and uses, applied in the use of DKK3 gene and related drugs, can solve problems such as failure to treat muscle atrophy

Active Publication Date: 2019-05-07
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current research has not found whether the expression level of Dkk3 is associated with the occurrence of muscle atrophy; there is no target for the treatment of aging-induced muscle atrophy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of dkk3 gene and related drugs
  • Use of dkk3 gene and related drugs
  • Use of dkk3 gene and related drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1 Preparation of RNAi adenovirus for DKK3 gene

[0068] 1. Screening for effective siRNA targets against the DKK3 gene

[0069] Obtain the mRNA sequence (NM_015814) of DKK3 from NCBI query, as follows:

[0070]

[0071]

[0072] By using software, design siDKK3 that specifically knocks down the expression of DKK3 protein, the sequence is as follows:

[0073] sense(5'-3')CCAGGAAGUUCACAAGAUAUU; (SEQ ID NO.1)

[0074] antisense (5'-3') UAUCUUGUGAACUUCCUGGUU (SEQ ID NO. 2).

[0075] Synthesize shRNADKK3 with this pair of siRNA sequences, the sequence is as follows:

[0076] TCGACCAGGAAGTTCACAAGATACTCGAGTATCTTGTGAACTTCCTGGTTTTT; (SEQ ID NO. 3)

[0077] AATTAAAAACCAGGAAGTTCACAAGATACTCGAGTATCTTGTGAACTTCCTGG (SEQ ID NO. 4).

[0078] Two-stage oligo, annealed according to the following system:

[0079] 10x annealing buffer 1ul; 100um oligo f: 4.5ul; 100um oligo r: 4.5ul; 95°C for 5min.

[0080] After cooling down to room temperature automatically, it was dou...

Embodiment 2

[0084] Example 2 Application of Knocking Down Muscle Atrophy Related Marker DKK3 to Treat Muscle Atrophy Caused by Aging

[0085] After the adenovirus interfering with Dkk3 was obtained in Example 1, the titer was 1.3x10 7 Tu / ml. The control group was adenovirus expressing GFP with a titer of 1.3x10 7 Tu / ml. Take 20-month-old C57 / BL wild-type mice, inject GFP virus into TA of left leg, and inject DKK3 interference virus into TA of right leg. 50 μl each time, after continuous injection for 7 days, they were fed for another 7 days. Use the muscle tension tester to test the tonic muscle tension of the TA muscles of the two legs. After the test, the TA was taken out, and half of the OCT was taken for embedding, which was quickly frozen in liquid nitrogen and used as a frozen section. Add 1ml TriZol to the other half, add 200μl chloroform, shake and mix well, centrifuge at 12,000 rpm at 4°C for 15 minutes, take the clear liquid from the upper layer, and transfer it to a new EP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology, and discloses an application and related medicines of a DKK3 gene. Firstly, the invention discloses the application of the DKK3 gene in screening muscular dystrophy treating medicines. The invention further constructs DKK3 gene small interference RNA, a DKK3 gene interference nucleic acid construct and a DKK3 gene interference virus and discloses applications thereof. The siRNA or the nucleic acid construct and virus containing the sequence of the siRNA provided by the invention can specifically inhibit the expression of the DKK3 gene, and especially, adenovirus can effectively infect target cells and inhibit the expression of the DKK3 gene in the target cells, so that muscular dystrophy can be effectively improved; therefore, the DKK3 gene has an important significance in the treatment of the muscular dystrophy.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to the use of DKK3 gene and related medicines. Background technique [0002] Existing diagnostic methods for muscle atrophy mainly include taking medical history, performing muscle appearance inspection, observing whether there are muscle fasciculations, observing whether the patient has obvious muscle mass loss, and making a diagnosis through electromyography combined with nerve conduction velocity and evoked potential. There is currently no molecular diagnostic method. In addition, for the aging-induced muscle atrophy and the decline of muscle function, there is currently no clear treatment method and a target that can be used as a therapeutic drug. [0003] Dkk3 is a member of the Dickkopf protein family and belongs to extracellular secreted protein. It mainly acts on the Wnt signaling pathway, and inhibits the activity of the Wnt signaling pathway by competing with...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/861A61K48/00A61K31/713A61P21/00
Inventor 胡苹尹杰
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com