Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing resveratrol oligomer from pichia pastoris

A technology of resveratrol and Pichia pastoris, applied in the field of genetic engineering and microbial fermentation, can solve the problems of low yield of resveratrol dimer, uncontrollable reaction direction, heavy environmental load, etc., and achieve low cost and easy Separate, not easy to lose effect

Inactive Publication Date: 2017-05-10
PROYA COSMETICS
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a method for preparing resveratrol dimer by using Pichia pastoris to solve the current problems of low resveratrol dimer yield, complex process, uncontrollable reaction direction and heavy environmental load

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing resveratrol oligomer from pichia pastoris
  • Method for preparing resveratrol oligomer from pichia pastoris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] The method for preparing resveratrol dimer extract by Pichia pastoris comprises the following steps:

[0027] 1) Add 1g 4-hydroxystilbene peroxidase gene, 2g pPU19 plasmid gene, 0.3mL restriction enzyme buffer, 10U restriction endonuclease EcoP1 and 10U EcoP15 and 100mL pure water in a sterilized centrifuge tube, at 30 Incubate at ℃ for 10 minutes, vortex for 10 seconds, centrifuge at 12000r / min for 2 minutes, and filter to obtain 4-hydroxystilbene peroxidase gene fragment 4TTS(+) and pPU19 plasmid gene fragment pPU19 after digestion (+) mixture. Wherein the gene sequence of 4-hydroxystilbene peroxidase gene fragment 4TTS (+) is:

[0028] GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTCAACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAAACCAGACAAGAAGCGTACATTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTCTTATATGGCTCCATCTCTTAACACGCCAAGAGATCAC.

[0029] 2) In a sterilized centrifuge tube, add 5 μL of the mixture containing 4-hydroxystilben...

Embodiment 2

[0035] The method for preparing resveratrol dimer extract by Pichia pastoris comprises the following steps:

[0036] 1) Add 1g 4-hydroxystilbene peroxidase gene, 2g pPU19 plasmid gene, 0.3mL restriction enzyme buffer, 10U restriction endonuclease EcoP1 and 10U EcoP15 and 100mL pure water in a sterilized centrifuge tube, at 32 Incubate at ℃ for 13 minutes, vortex for 12 seconds, centrifuge at 12000r / min for 2 minutes, and filter to obtain 4-hydroxystilbene peroxidase gene fragment 4TTS(+) and pPU19 plasmid gene fragment pPU19 after digestion (+) mixture. Wherein the gene sequence of 4-hydroxystilbene peroxidase gene fragment 4TTS (+) is:

[0037] GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTCAACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAAACCAGACAAGAAGCGTACATTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTCTTATATGGCTCCATCTCTTAACACGCCAAGAGATCAC.

[0038] 2) In a sterilized centrifuge tube, add 5 μL of the mixture containing 4-hydroxystilben...

Embodiment 3

[0044] The method for preparing resveratrol dimer extract by Pichia pastoris comprises the following steps:

[0045] 1) Add 1g 4-hydroxystilbene peroxidase gene, 2g pPU19 plasmid gene, 0.3mL restriction enzyme buffer, 10U restriction endonuclease EcoP1 and 10U EcoP15 and 100mL pure water in a sterilized centrifuge tube, at 33 Incubate at ℃ for 15 min, vortex shake for 14 s, centrifuge at 13000 r / min for 3 min, and filter to obtain 4-hydroxystilbene peroxidase gene fragment 4TTS(+) and pPU19 plasmid gene fragment pPU19 after digestion (+) mixture. Wherein the gene sequence of 4-hydroxystilbene peroxidase gene fragment 4TTS (+) is:

[0046]GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTCAACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAAACCAGACAAGAAGCGTACATTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTCTTATATGGCTCCATCTCTTAACACGCCAAGAGATCAC.

[0047] 2) In a sterilized centrifuge tube, add 5 μL of the mixture containing 4-hydroxystilbene peroxi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
heightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing a resveratrol oligomer from pichia pastoris. The method mainly comprises the following steps of constructing a pPU19 plasmid vector comprising a 4-hydroxystilbene peroxidase gene, transforming a recombinant plasmid expression carrier pPU19-4TTS into a Komagataella pastoris DSMZ 70382 pichia pastoris strain to obtain the pichia pastoris with expressed 4-hydroxystilbene peroxidase, preparing a fermentation product comprising the resveratrol oligomer, and separating the resveratrol oligomer. The pichia pastoris is applied for the first time, the 4-hydroxystilbene peroxidase gene, which is key to the production of the resveratrol oligomer, is transferred into the pichia pastoris through a genetic engineering method, and screening is conducted to obtain the high through-put expression 4-hydroxystilbene peroxidase pichia pastoris strain. The resveratrol oligomer is prepared through a microbiological fermentation method; and the purity of the resveratrol oligomer obtained through separation according to the method is 45-60%, wherein the rate of transforming resveratrol into the resveratrol oligomer is 35%-45%.

Description

technical field [0001] The invention relates to the technical fields of genetic engineering and microbial fermentation, in particular to a method for preparing resveratrol dimer extract by using Pichia pastoris. Background technique [0002] Resveratrol dimer (viniferins) is formed by the oxidation of resveratrol by 4-hydroxystilbene peroxidase (4-trihydroxy-trans-stilbene); It is a phytoalexin secreted by the body; it has stronger antioxidant properties than resveratrol, can effectively remove and inhibit the production of free radicals, and can also inhibit lipid peroxidation and DNA loss; it can improve the activity of platelets and relieve allergies Symptoms and anti-inflammatory effect. [0003] Resveratrol dimer exists in grape leaf epidermis, berry peel and grape seed, the content is extremely low. Although methods such as ultraviolet irradiation, fungal infection, and mechanical damage can stimulate the synthesis of resveratrol dimers, the effect is not good. The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P17/04C12N1/19C12R1/84
CPCC12N9/0065C12P17/04
Inventor 李欣航张金龙杨盼盼海陶蒋丽刚李文倩陈伟
Owner PROYA COSMETICS