Method for preparing resveratrol oligomer from pichia pastoris
A technology of resveratrol and Pichia pastoris, applied in the field of genetic engineering and microbial fermentation, can solve the problems of low yield of resveratrol dimer, uncontrollable reaction direction, heavy environmental load, etc., and achieve low cost and easy Separate, not easy to lose effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] The method for preparing resveratrol dimer extract by Pichia pastoris comprises the following steps:
[0027] 1) Add 1g 4-hydroxystilbene peroxidase gene, 2g pPU19 plasmid gene, 0.3mL restriction enzyme buffer, 10U restriction endonuclease EcoP1 and 10U EcoP15 and 100mL pure water in a sterilized centrifuge tube, at 30 Incubate at ℃ for 10 minutes, vortex for 10 seconds, centrifuge at 12000r / min for 2 minutes, and filter to obtain 4-hydroxystilbene peroxidase gene fragment 4TTS(+) and pPU19 plasmid gene fragment pPU19 after digestion (+) mixture. Wherein the gene sequence of 4-hydroxystilbene peroxidase gene fragment 4TTS (+) is:
[0028] GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTCAACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAAACCAGACAAGAAGCGTACATTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTCTTATATGGCTCCATCTCTTAACACGCCAAGAGATCAC.
[0029] 2) In a sterilized centrifuge tube, add 5 μL of the mixture containing 4-hydroxystilben...
Embodiment 2
[0035] The method for preparing resveratrol dimer extract by Pichia pastoris comprises the following steps:
[0036] 1) Add 1g 4-hydroxystilbene peroxidase gene, 2g pPU19 plasmid gene, 0.3mL restriction enzyme buffer, 10U restriction endonuclease EcoP1 and 10U EcoP15 and 100mL pure water in a sterilized centrifuge tube, at 32 Incubate at ℃ for 13 minutes, vortex for 12 seconds, centrifuge at 12000r / min for 2 minutes, and filter to obtain 4-hydroxystilbene peroxidase gene fragment 4TTS(+) and pPU19 plasmid gene fragment pPU19 after digestion (+) mixture. Wherein the gene sequence of 4-hydroxystilbene peroxidase gene fragment 4TTS (+) is:
[0037] GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTCAACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAAACCAGACAAGAAGCGTACATTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTCTTATATGGCTCCATCTCTTAACACGCCAAGAGATCAC.
[0038] 2) In a sterilized centrifuge tube, add 5 μL of the mixture containing 4-hydroxystilben...
Embodiment 3
[0044] The method for preparing resveratrol dimer extract by Pichia pastoris comprises the following steps:
[0045] 1) Add 1g 4-hydroxystilbene peroxidase gene, 2g pPU19 plasmid gene, 0.3mL restriction enzyme buffer, 10U restriction endonuclease EcoP1 and 10U EcoP15 and 100mL pure water in a sterilized centrifuge tube, at 33 Incubate at ℃ for 15 min, vortex shake for 14 s, centrifuge at 13000 r / min for 3 min, and filter to obtain 4-hydroxystilbene peroxidase gene fragment 4TTS(+) and pPU19 plasmid gene fragment pPU19 after digestion (+) mixture. Wherein the gene sequence of 4-hydroxystilbene peroxidase gene fragment 4TTS (+) is:
[0046]GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTCAACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAAACCAGACAAGAAGCGTACATTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTCTTATATGGCTCCATCTCTTAACACGCCAAGAGATCAC.
[0047] 2) In a sterilized centrifuge tube, add 5 μL of the mixture containing 4-hydroxystilbene peroxi...
PUM
| Property | Measurement | Unit |
|---|---|---|
| height | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 

