Esophageal carcinoma prognosis marker and application thereof

A prognostic marker and technology for esophageal cancer, applied in the field of genetic engineering and oncology, to achieve the effect of improving accuracy and sequence conservation

Active Publication Date: 2017-05-24
GENERAL HOSPITAL OF PLA
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In other words, the change of chromosomal fragile loci as the origin genetic event of esophageal cancer can lead to the occurrence of two parallel events—functional gene and miRNA expression changes—and finally lead to the occurrence of esophageal cancer
Therefore, the impact of chr9q32-related miR-455 on the prognosis of esophageal cancer remains to be explored

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Esophageal carcinoma prognosis marker and application thereof
  • Esophageal carcinoma prognosis marker and application thereof
  • Esophageal carcinoma prognosis marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Detection of loss of heterozygosity in the 9q32 region

[0062] The inventor collected 120 freshly resected esophageal cancer samples and 60 paired esophageal cancer samples at the General Hospital of the Chinese People's Liberation Army, and systematically collected the demographic and clinical data of these samples.

[0063] Genomic DNA was extracted from the above 60 paired esophageal cancer specimens (using QIAGEN’s Blood&Tissue Kit), the specific steps are:

[0064] 1. Weigh 20mg of tissue into a 1.5ml centrifuge tube, add 180μl Buffer ATL, then add 20μl proteinase K, vortex to mix, incubate at 56°C until the tissue is completely lysed, and vortex several times during the incubation.

[0065] 2. Add 200 μl Buffer AL, vortex to mix, and incubate at 56°C for 10 minutes.

[0066] 3. Add 200 μl of absolute ethanol and vortex to mix.

[0067] 4. Transfer all the above mixed solution into the DNeasy Mini spin column, centrifuge at 8000rpm for 1min, and disc...

Embodiment 2

[0083] Example 2 Detection of miR-455 expression

[0084] 1. Total RNA was extracted from 120 esophageal cancer samples and 60 paired esophageal cancer samples. The specific method is as follows:

[0085] 2. Take 20mg of each sample, add 1ml TriZol reagent, grind, centrifuge at 12000g for 2min, take the upper layer liquid into a new 1.5ml centrifuge tube.

[0086] 3. Incubate on ice for 15min, add 200μl chloroform, vortex for 30s, incubate for 5min, centrifuge at 12000g, 4°C for 10min.

[0087] 4. Take the upper aqueous phase to a new 1.5ml centrifuge tube, add 500μl isopropanol, incubate on ice for 15min, centrifuge at 12000g, 4°C for 15min, discard the supernatant.

[0088] 5. Add 1ml of 75% ethanol, vortex for 10s, centrifuge at 6000g for 5min at 4°C, discard the supernatant, and dry in the air.

[0089] 6. Add appropriate amount of RNase-free water to dissolve.

[0090] RNA with poly(U) tails (New England Biolabs)

[0091] 1. Take 10ng of total RNA, UTP, poly(U) polyme...

Embodiment 3

[0107] Embodiment 3 Implementation is used to assist in judging the miRNA kit making of the prognosis of patients with esophageal cancer

[0108] (1) The production and operation process of the miRNA kit is based on technologies such as total RNA plus poly(U) tail, RT-PCR and Real-time PCR.

[0109] Kit includes:

[0110] Primers (including reverse transcription universal primer SL-poly(A): GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAAAAAAAAAAAAAAVN;

[0111] miR-455 upstream primer: GAACTGCAGTCCATGGGCATA;

[0112] Internal reference U6 upstream primer: CTCGCTTCGGCAGCACA;

[0113] Universal downstream primer: GCAGGGTCCGAGGTATTC).

[0114] Reagents required for PCR reaction, including: RNA isolation solution, PCR reaction solution, buffer, poly(U) polymerase, reverse transcriptase, universal reverse transcription primer (poly(A)

[0115] RNA separation solution; the RNA separation solution is composed of Tween 20, trishydroxymethylaminomethane, ethylenediaminetetraacet...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of genetic engineering and phymatology, relates to an esophageal carcinoma prognosis marker and application thereof, and in particular relates to a miRNA marker related to esophageal carcinoma chromosome 9q32 heterozygosity loss and application of the miRNA marker. The primer is a primer of the miRNA marker related to esophageal carcinoma chromosome 9q32 heterozygosity loss.

Description

[0001] field of invention [0002] The invention belongs to the field of genetic engineering and oncology, and relates to a prognostic marker for esophageal cancer and its application, in particular to a miRNA marker related to loss of heterozygosity in the chromosome 9q32 region of esophageal cancer and its application Background technique [0003] Esophageal cancer is one of the six most common malignant tumors in the world, and my country is the region with the highest incidence and mortality rate of esophageal cancer in the world. Of the approximately 500,000 new cases of esophageal cancer each year in the world, more than half occur in China, which is 100 times higher than in Western countries, and the 5-year survival rate is only about 15%. The occurrence of esophageal cancer has significant regional distribution differences and family aggregation, suggesting that environmental and genetic factors play an important role in the occurrence of esophageal cancer. The result...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/118C12Q2600/178
Inventor梅倩韩为东李祥孟元光施路郭明洲张康
OwnerGENERAL HOSPITAL OF PLA