Insecticidal fusion protein, coding gene and application thereof
A fusion protein and coding gene technology, applied in the application field of the above fusion protein, to achieve the effects of expanding the insecticidal spectrum, delaying the generation of pest resistance, and widening the insecticidal spectrum
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1, Construction of IPD072Aa-Vip3A insecticidal fusion protein expression vector
[0028] Both IPD072Aa and Vip3A insecticidal protein genes were synthesized by Shanghai Sangong, and their DNA sequences were SEQ ID NO: 5 and SEQ ID NO: 7 in Chinese patent 200610049611.0, and were cloned into the pET28a expression vector with restriction enzymes BamHI and Between SacI sites. The constructed vectors were named pET28a-IPD072Aa and pET28a-Vip3A, respectively.
[0029] The specific steps of IPD072Aa-Vip3A synthesis are as follows:
[0030]1. Using Vip3A (SEQ ID NO: 7 in Chinese patent 200610049611.0) as a template to obtain the Vip3A gene fragment by PCR. The primers were: Vip3A-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACACCAAG and Vip3A-R: 5'CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTCACGA. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.
[0031] 2. The PCR product was treated with XmalI and ScaI, and ligated with the pET28a-IPD072A...
Embodiment 2
[0033] Example 2, Construction of IPD072Aa-Vip3H fusion protein expression vector
[0034] Both IPD072Aa and Vip3H insecticidal protein genes were synthesized by Shanghai Sangong, and their DNA sequences were SEQ ID NO: 5 and SEQ ID NO: 6, respectively, and were cloned between the restriction endonuclease BamHI and SacI sites of the pET28a expression vector . The constructed vectors were named pET28a-IPD072Aa and pET28a-Vip3H, respectively.
[0035] The specific steps for the synthesis of IPD072Aa-Vip3H are as follows:
[0036] 4. Using Vip3H (SEQ ID NO: 6) as a template to perform PCR to obtain the Vip3A gene fragment. The primers were: Vip3H-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACAGTAAG and Vip3H-R: 5'CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGGTGATGT. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.
[0037] 5. The PCR product was treated with XmalI and ScaI, and ligated with the pET28a-IPD072Aa vector treated with the same enzymes.
[0...
Embodiment 3
[0039] Embodiment 3, the expression of insecticidal protein
[0040] The expression vectors (pET28a-IPD072Aa-Vip3A, pET28a-IPD072Aa-Vip3H, pET28a-IPD072Aa, pET28a-Vip3A and pET28a-Vip3H) containing the fusion protein gene were transformed into Escherichia coli BL21star using general standard methods. Pick a monoclonal colony and inoculate it into 100ml LB bacterial culture medium, shake and cultivate to OD at 37°C 600 =0.6, add IPTG to 0.5mM, and continue to incubate under the same conditions for 4 hours. The collected culture solution was centrifuged at 5000 g for 10 minutes to precipitate E. coli cells, and then the supernatant was discarded to collect the precipitate. Add 30 ml of pH 7.5, 20 mM Tris-HCL buffer solution to the precipitate, and ultrasonically pulverize it, then it can be used for the determination of insecticidal activity.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com