Unlock instant, AI-driven research and patent intelligence for your innovation.

Insecticidal fusion protein, coding gene and application thereof

A fusion protein and coding gene technology, applied in the application field of the above fusion protein, to achieve the effects of expanding the insecticidal spectrum, delaying the generation of pest resistance, and widening the insecticidal spectrum

Active Publication Date: 2017-06-13
ZHEJIANG UNIV
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still some problems in the actual operation and application of the above method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insecticidal fusion protein, coding gene and application thereof
  • Insecticidal fusion protein, coding gene and application thereof
  • Insecticidal fusion protein, coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1, Construction of IPD072Aa-Vip3A insecticidal fusion protein expression vector

[0028] Both IPD072Aa and Vip3A insecticidal protein genes were synthesized by Shanghai Sangong, and their DNA sequences were SEQ ID NO: 5 and SEQ ID NO: 7 in Chinese patent 200610049611.0, and were cloned into the pET28a expression vector with restriction enzymes BamHI and Between SacI sites. The constructed vectors were named pET28a-IPD072Aa and pET28a-Vip3A, respectively.

[0029] The specific steps of IPD072Aa-Vip3A synthesis are as follows:

[0030]1. Using Vip3A (SEQ ID NO: 7 in Chinese patent 200610049611.0) as a template to obtain the Vip3A gene fragment by PCR. The primers were: Vip3A-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACACCAAG and Vip3A-R: 5'CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTCACGA. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.

[0031] 2. The PCR product was treated with XmalI and ScaI, and ligated with the pET28a-IPD072A...

Embodiment 2

[0033] Example 2, Construction of IPD072Aa-Vip3H fusion protein expression vector

[0034] Both IPD072Aa and Vip3H insecticidal protein genes were synthesized by Shanghai Sangong, and their DNA sequences were SEQ ID NO: 5 and SEQ ID NO: 6, respectively, and were cloned between the restriction endonuclease BamHI and SacI sites of the pET28a expression vector . The constructed vectors were named pET28a-IPD072Aa and pET28a-Vip3H, respectively.

[0035] The specific steps for the synthesis of IPD072Aa-Vip3H are as follows:

[0036] 4. Using Vip3H (SEQ ID NO: 6) as a template to perform PCR to obtain the Vip3A gene fragment. The primers were: Vip3H-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACAGTAAG and Vip3H-R: 5'CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGGTGATGT. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.

[0037] 5. The PCR product was treated with XmalI and ScaI, and ligated with the pET28a-IPD072Aa vector treated with the same enzymes.

[0...

Embodiment 3

[0039] Embodiment 3, the expression of insecticidal protein

[0040] The expression vectors (pET28a-IPD072Aa-Vip3A, pET28a-IPD072Aa-Vip3H, pET28a-IPD072Aa, pET28a-Vip3A and pET28a-Vip3H) containing the fusion protein gene were transformed into Escherichia coli BL21star using general standard methods. Pick a monoclonal colony and inoculate it into 100ml LB bacterial culture medium, shake and cultivate to OD at 37°C 600 =0.6, add IPTG to 0.5mM, and continue to incubate under the same conditions for 4 hours. The collected culture solution was centrifuged at 5000 g for 10 minutes to precipitate E. coli cells, and then the supernatant was discarded to collect the precipitate. Add 30 ml of pH 7.5, 20 mM Tris-HCL buffer solution to the precipitate, and ultrasonically pulverize it, then it can be used for the determination of insecticidal activity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an insecticidal fusion protein which comprises IPD072 protein and Vip3 protein. Compared with the previous IPD072 protein and Vip3 protein, the designed artificial protein molecule formed by fusing IPD072 protein and Vip3 toxin has the following advantages: the insecticidal spectrum is broad, multiple important pests (such as laphygma exigua, armyworm and diabrotica virgifera) of lepidoptera and coleoptera can be controlled at the same time, and the insecticidal efficiency is as high as 50-100%; and moreover, the joint utilization of proteins with different functions and other insect-resistant proteins (such as ICPs) is promoted, the insecticidal spectrum is further expanded, and the generation of insect resistance is delayed.

Description

[0001] (1) Technical field [0002] The invention relates to an insecticidal fusion protein, an encoding gene of the insecticidal fusion, and the application of the fusion protein. [0003] (2) Background technology [0004] Pests have brought huge losses to global agricultural production. At present, pest control mainly relies on chemical pesticides, but the use of pesticides has increased production costs, and pesticide residues have caused serious harm to human health. Therefore, the use of genetic engineering methods to control pests has great economic, environmental and social value. [0005] The key to obtaining transgenic insect-resistant crops is to clone good insecticidal proteins. There are many insecticidal proteins, and the most widely used one is a kind of accompanying cell crystal protein (insecticidalcrystal proteins, ICP) secreted by Bacillus thuringiensis (Bt) during cell production, such as Cry1Ab, Cry1C, etc. Lepidoptera, Diptera, Coleoptera and other insec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N1/21C12N15/82A01H5/00
CPCC07K14/21C07K14/325C07K2319/00C12N15/8286
Inventor 张先文王东芳赵宇沈志成
Owner ZHEJIANG UNIV