A new insecticidal protein and its nucleotide sequence
A technology of insecticidal protein and nucleic acid, applied in the direction of insecticides, immunoglobulins, anti-bacterial immunoglobulins, etc., can solve the problems of singleness and increased resistance of pests, reduce food intake, improve insect resistance, Delays the effect of resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0056] Table 1 is the preparation table of SDS polyacrylamide gel.
[0057] Table 1 Preparation table of SDS polyacrylamide gel
[0058]
Embodiment 1
[0060] Screening and cloning of new genes
[0061] PCR-RFLP identification: 2000 strains of Bacillus thuringiensis (Bt) kept in the laboratory were extracted, quantified, and homogenized, and then mixed in equal amounts to establish a Bt genome pool, which was used as a PCR template, using primer S5un2 (SEQ ID No. 3): GGAAGAACTACTATTTGTGATGC; S3un2 (SEQ ID No. 4): AATAGTTTGAATTACCGCGAGC, PCR amplification was performed. Amplification cycle: denaturation at 94°C for 1min; annealing at 54°C for 1min; extension at 72°C for 2min20s; 30 cycles, and finally extension at 72°C for 10min. PCR products were detected by 0.7% agarose gel electrophoresis. Then, the PCR product was digested with RFLP, combined with the sequencing analysis of the PCR product, a new gene was found, which was tentatively named cry2A-like.
[0062] Cloning and expression of new genes: Using the established Bt genome pool as a template, using primer cry2F: 5'- CCGGAATTCg ATGAATAATGTATTG-3'; cry2R:5'- CCCAAGC...
Embodiment 2
[0066] Protein expression and quantitative analysis
[0067] Escherichia coli Rosetta (DE3) strain carrying cry2A-like gene was inoculated in LB liquid medium at an inoculum size of 1%, and cultivated to OD at 37°C 600 When the value reaches between 0.5-1.0, add the inducer 50mM IPTG, induce at 150rpm, 20 ℃ low temperature for 12h. Then centrifuge at 8000 rpm for 3 min at 4°C. The bacterial cells were collected by centrifugation, suspended by adding 50 mM Tris·Cl (pH 8.0); the bacterial cells were disrupted (completely disrupted by ultrasonic routine), and the sonicated bacterial liquid was centrifuged at 12,000 rpm for 15 min at 4°C; then the supernatant was collected. Perform SDS-PAGE quantitative analysis on the supernatant as follows: prepare the following five different concentration gradients of BSA: 0.8 μg / μL, 0.4 μg / μL, 0.2 μg / μL, 0.1 μg / μL, 0.05 μg / μL , and the target protein was serially diluted so that the final concentration was between 0.8-0.05 μg / μL, and the sa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More