Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection method and application of rice blast resistance gene Pigm

A detection method and genetic technology, applied in the field of agricultural biology, can solve the problems of poor marker stability and poor repeatability of experimental results, and achieve the effects of reducing labor costs and time costs, low cost, and high stability

Active Publication Date: 2017-07-07
SHENZHEN XINGWANG BIOLOGICAL SEED IND +1
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the detection results of these two markers for the Pigm gene are judged according to the presence or absence of the target band. Such markers are not stable, and the repeatability of the experimental results is not strong. There is a big problem in large-scale molecular assisted selection breeding limitations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method and application of rice blast resistance gene Pigm
  • Detection method and application of rice blast resistance gene Pigm
  • Detection method and application of rice blast resistance gene Pigm

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Analysis of specific single base polymorphism (SNP) near both ends of Pigm

[0044] Since the Pigm gene has not been cloned yet, its detailed DNA sequence cannot be known, and specific primers cannot be designed for its functional variation to detect its presence or absence. Using the rice 60K gene chip to scan the whole genome of Gumei 4, Wuyunjing 7 and 9311, and select the mutation sites that are different from Gumei 4, Wuyunjing 7 and 9311 near both ends of the Pigm gene (such as Table 1) to design HRM primers so that a molecular marker that is completely co-segregated with Pigm is developed near both ends, and the two specific mutation sites are respectively T→C and A→C, specifically as the following SEQ ID NO: 5 and shown in SEQID NO:6.

[0045] 5'-

[0046] GCTTAATCAAGCCCATTTCCTCTATAACCACAGAGGATGAGAGGGATTCCTACCTAGAAGATGCT T /

[0047] CGCAATCGATCAGGTAGCAACACTGACGAGTCAGAACTTGTGGGCT-3' (SEQ ID NO: 5);

[0048] 5'-

[0049] AAGCTGTCACGACCTGAGAAGGGAT...

Embodiment 2

[0054] Example 2: Pigm co-segregation molecular marker primer design and HRM detection

[0055] (1) Primer design

[0056] According to the principle of HRM primer design, a pair of gene-specific molecular marker primers were designed near the two ends of the Pigm gene. The base sequences of the primer pairs are as follows:

[0057] Pigm-HRM-1F: 5'-GCTTAATCAAGCCCATTTCC-3' (SEQ ID NO: 1);

[0058] Pigm-HRM-1R: 5'-AGCCCACAAGTTCTGACTCG-3' (SEQ ID NO: 2);

[0059] Pigm-HRM-2F: 5'-AAGCTGTCACGACCTGAGAAG-3' (SEQ ID NO: 3);

[0060] Pigm-HRM-2R: 5'-CGTGCTCACCTGTGAGTTCTA-3' (SEQ ID NO: 4);

[0061] (2) HRM detection

[0062] The rice material "Gumei 4", rice two-line male sterile line, The DNA templates of the three-line maintainer line, restorer line, conventional rice, and other rice disease-resistant parents (as shown in Table 2) were amplified by PCR, and the amplified products were collected by HRM instrument LightScanner96 with high-resolution melting curves to obtain the po...

Embodiment 3

[0082] Example 3: Application analysis of Pigm co-segregation molecular markers in assisted breeding

[0083] The rice material containing the rice blast resistance gene Pigm was used as the parent of "Gumei No. 4", and it was crossed with other rice varieties that did not contain the rice blast resistance gene Pigm, and the genomic DNA of the hybrid offspring and the two parents were extracted, and the primer pair Pigm- HRM-1F / 1R and Pigm-HRM-2F / 2R were amplified by PCR respectively, and the high-resolution melting curves of the amplified products showed three types, among which the melting curve of the positive control "Gumei No. 4" was red, The other control parent is blue, and the hybrid offspring of the two parents is gray, and the peak is significantly lower than that of the two parents (such as image 3 and Figure 4 ). The F of two parents containing Pigm gene and not containing the gene 2 The 46 samples of isolated individuals were subjected to molecular detection ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection method and application of a rice blast resistance gene Pigm, belongs to the technical field of agricultural biology and particularly relates to a specific molecular marker for High-Resolution Melting Curve Analysis (HRM) of the rice blast resistance gene Pigm and a method for detecting the rice blast resistance gene Pigm by virtue of a primer. According to the detection method, a rice 60K gene chip is utilized for carrying out whole-genome scanning on Gumei #4, and wuyunjing #7 and 9311, an HRM primer is designed by virtue of different variation sites, on which Gumei #4 are different from wuyunjing #7 and 9311, close to two ends of the gene Pigm, a molecular marker completely co-separated from Gumei is developed at each of two ends, and a middle-high-flux assistant selection system is established, so that the disease-resistant breeding efficiency of rice can be greatly improved.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to a high-resolution melting curve analysis (High-Resolution Melting Curve Analysis, HRM) specific molecular marker of the rice blast resistance gene Pigm, And a method for detecting rice blast resistance gene Pigm by using the primers. Background technique [0002] Rice is one of the most important food crops in the world. More than half of the world's population takes rice as a staple food, and more than 60% of my country's population takes rice as a staple food. Rice blast caused by Ascomycetes (Magnapothe oryzae) is one of the most important diseases affecting rice production widely in various rice regions in the world, and it causes serious grain loss every year. Practice has proved that breeding and planting wide disease-resistant varieties is the most economical and effective way to control rice diseases. In recent years, important progress has been mad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 金名捺丘式浚唐晓艳邓兴旺
Owner SHENZHEN XINGWANG BIOLOGICAL SEED IND