Typing detection method and kit for high-risk human papilloma virus (HPV)
A technology of human papillomavirus and detection method, which is applied in the field of high-risk human papillomavirus typing detection methods and kits, and can solve the problems of restriction of types of gene sequence detection and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0123] Embodiment 1 Human papillomavirus 16, 18, 31, 52, 59 type nucleic acid typing detection kit (fluorescent PCR method)
[0124] 1. Primer Probe Synthesis
[0125] Entrust Yingwei Jieji (Shanghai) Trading Co., Ltd. to synthesize the primer probe. The sequence of the synthesized primer probe is as follows:
[0126] The upstream primers are:
[0127] 5'-CAACTATTTGTTACTGTTGTTGATACTAC-3' as shown in SEQ ID No.1;
[0128] 5'- CAATTATTTGTTACTGTGGTAGATACCAC -3' as shown in SEQ ID No.2;
[0129] 5'-CAGTTGTTTGTCACAGTTGTGGATACCAC-3' as shown in SEQ ID No.3;
[0130] 5'-CAATTGTTTTTAACAGTTGTAGATCCTAC-3', as shown in SEQ ID No.4;
[0131] Downstream primers are:
[0132] 5'-GAAATATAAACTGCAAATCAAATTCCTC-3', as shown in SEQ ID No.5;
[0133] 5'- GAAAAATAAATTGTAAATCAAATTCCTC-3', as shown in SEQ ID No.6;
[0134] 5'-GAAATATAAATTGTAAATCAAATTCCTC-3', as shown in SEQ ID No.7;
[0135] 5'- GAAAAATAAACTGCAAATCATATTCCTC-3', as shown in SEQ ID No.8;
[0136] 5'-GAAAAATAAACTGTAAATCATATTCC...
Embodiment 2
[0165] Application of embodiment 2 human papillomavirus 16, 18, 31, 52, 59 type nucleic acid typing detection kit (fluorescent PCR method)
[0166] Using the kit obtained in the present invention to test 20 cases of clinical samples, and at the same time use the human papillomavirus genotyping (type 25) detection kit (PCR-reverse dot hybridization method) produced by Aikang Biotechnology Co., Ltd. for parallel comparison Test and evaluate the effect of the kit.
[0167] 1. Human papillomavirus 16, 18, 31, 52, 59 nucleic acid typing detection kit (fluorescent PCR method) for detection of clinical samples
[0168] (1) Reagent preparation
[0169] Prepare the reaction solution according to the number of samples n (number of samples = number of samples to be tested + 3 reference substances + 1):
[0170] Take PCR buffer n×9 μL, enzyme mixture n×3 μL, primer probe n×8 μL in a centrifuge tube and mix evenly; centrifuge at low speed for a few seconds, and dispense 20 μL / tube into r...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



