Engineering bacteria based on ilv attenuator and application of engineering bacteria to isoleucine production
An attenuator and molecular technology, applied in the production of isoleucine, based on the ilv attenuator in the field of engineering bacteria, can solve the problems of L-isoleucine synthesis pathway and complex regulation methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0119] Example 1. Construction of E.coli K-12W3110△metA△lysA△tdh△tdcC
[0120] Using Escherichia coli K12W3110 as the starting strain, the metA gene (the gene encoding homoserine succinyltransferase), the lysA gene (the gene encoding diaminopimelate decarboxylase), and the tdh gene (the gene encoding threonine dehydratase) were sequentially deleted. gene) and tdcC gene (the gene encoding the threonine uptake transporter) to obtain the chassis engineering bacteria, which was named E.coliK-12W3110△metA△lysA△tdh△tdcC.
[0121] 1. Knock out the metA gene
[0122] (1) The genomic DNA of Escherichia coli K12W3110 was used as a template, and the primer pair composed of WY569 and WY570 was used for PCR amplification to obtain DNA fragment I-A (upstream region of the metA gene).
[0123] (2) Using the genomic DNA of Escherichia coli K12W3110 as a template, the primer pair composed of WY571 and WY572 was used for PCR amplification to obtain DNA fragment I-B (the downstream region of th...
Embodiment 2
[0182] Embodiment 2, preparation isoleucine
[0183] 1. Preparation of threonine operon with thrA mutant gene
[0184] 1. Using the genome of Escherichia coli K12W3110 as a template, PCR amplification was performed using a primer pair composed of WY914 and WY926 to obtain a PCR amplification product.
[0185] WY914: CCC AAGCTT ACAGAGTACACAACATCCATG;
[0186] WY926: GTAGGAAAGCTCCATCGC CTGGTAGGACATCGACTTC.
[0187] 2. Taking the genome of Escherichia coli K12W3110 as a template and using a primer pair composed of WY925 and WY832 to carry out PCR amplification to obtain a PCR amplification product.
[0188] WY925: GAAGTCGATGTCCTACCAG GCGATGGAGCTTTCCTAC;
[0189] WY832: CCC GATATC GCATTTATTGAGAATTTCTCC.
[0190] 3. Mix the PCR amplification product obtained in step 1 and the PCR amplification product obtained in step 2 as a template, and perform PCR amplification with a primer pair composed of WY914 and WY832 to obtain a PCR amplification product.
[0191] After seque...
Embodiment 3
[0288] Embodiment 3, attenuator mutant regulates the expression of gfp gene
[0289] 1. Construction of recombinant plasmid pACYC184-P thr-trc
[0290] 1. Synthesize the double-stranded DNA molecule shown in sequence 21 of the sequence listing (promoter P thr-trc ).
[0291] 2. Using the genomic DNA of Escherichia coli K12MG1655 as a template, PCR amplification was performed using a primer pair composed of WY1947 and WY1948 to obtain a PCR amplification product.
[0292] WY1947:CTAG TCTAGA GCTTTTCATTCTGACTGCAAC;
[0293] WY1948: CCC AAGCTT ACATTATACGAGCCGGATGATTAATTGTCAACTGTCTGTGCGCTATGCCT.
[0294] 3. Take the PCR amplification product obtained in step 2, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the digested product.
[0295] 4. Take the pACYC184 plasmid, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the vector backbone (about 4.1 kb).
[0296] 5. Ligate the digested product of...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com