Engineering bacteria based on ilv attenuator and application of engineering bacteria to isoleucine production

An attenuator and molecular technology, applied in the production of isoleucine, based on the ilv attenuator in the field of engineering bacteria, can solve the problems of L-isoleucine synthesis pathway and complex regulation methods

Active Publication Date: 2017-08-18
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the synthesis pathway and regulation of L-isoleucine in microorganisms are complex, which is the key limiting factor for the efficient fermentation of L-isoleucine and its derivatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0119] Example 1. Construction of E.coli K-12W3110△metA△lysA△tdh△tdcC

[0120] Using Escherichia coli K12W3110 as the starting strain, the metA gene (the gene encoding homoserine succinyltransferase), the lysA gene (the gene encoding diaminopimelate decarboxylase), and the tdh gene (the gene encoding threonine dehydratase) were sequentially deleted. gene) and tdcC gene (the gene encoding the threonine uptake transporter) to obtain the chassis engineering bacteria, which was named E.coliK-12W3110△metA△lysA△tdh△tdcC.

[0121] 1. Knock out the metA gene

[0122] (1) The genomic DNA of Escherichia coli K12W3110 was used as a template, and the primer pair composed of WY569 and WY570 was used for PCR amplification to obtain DNA fragment I-A (upstream region of the metA gene).

[0123] (2) Using the genomic DNA of Escherichia coli K12W3110 as a template, the primer pair composed of WY571 and WY572 was used for PCR amplification to obtain DNA fragment I-B (the downstream region of th...

Embodiment 2

[0182] Embodiment 2, preparation isoleucine

[0183] 1. Preparation of threonine operon with thrA mutant gene

[0184] 1. Using the genome of Escherichia coli K12W3110 as a template, PCR amplification was performed using a primer pair composed of WY914 and WY926 to obtain a PCR amplification product.

[0185] WY914: CCC AAGCTT ACAGAGTACACAACATCCATG;

[0186] WY926: GTAGGAAAGCTCCATCGC CTGGTAGGACATCGACTTC.

[0187] 2. Taking the genome of Escherichia coli K12W3110 as a template and using a primer pair composed of WY925 and WY832 to carry out PCR amplification to obtain a PCR amplification product.

[0188] WY925: GAAGTCGATGTCCTACCAG GCGATGGAGCTTTCCTAC;

[0189] WY832: CCC GATATC GCATTTATTGAGAATTTCTCC.

[0190] 3. Mix the PCR amplification product obtained in step 1 and the PCR amplification product obtained in step 2 as a template, and perform PCR amplification with a primer pair composed of WY914 and WY832 to obtain a PCR amplification product.

[0191] After seque...

Embodiment 3

[0288] Embodiment 3, attenuator mutant regulates the expression of gfp gene

[0289] 1. Construction of recombinant plasmid pACYC184-P thr-trc

[0290] 1. Synthesize the double-stranded DNA molecule shown in sequence 21 of the sequence listing (promoter P thr-trc ).

[0291] 2. Using the genomic DNA of Escherichia coli K12MG1655 as a template, PCR amplification was performed using a primer pair composed of WY1947 and WY1948 to obtain a PCR amplification product.

[0292] WY1947:CTAG TCTAGA GCTTTTCATTCTGACTGCAAC;

[0293] WY1948: CCC AAGCTT ACATTATACGAGCCGGATGATTAATTGTCAACTGTCTGTGCGCTATGCCT.

[0294] 3. Take the PCR amplification product obtained in step 2, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the digested product.

[0295] 4. Take the pACYC184 plasmid, perform double digestion with restriction endonucleases Xba I and Hind III, and recover the vector backbone (about 4.1 kb).

[0296] 5. Ligate the digested product of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses engineering bacteria based on an ilv attenuator and an application of the engineering bacteria to isoleucine production and provides an ilv attenuator mutant. The ilv attenuator mutant is a DNA molecule obtained by removing 1st-n4th-position nucleotides from the ilv attenuator, wherein n4 is larger than or equal to 128 and smaller than or equal to 147. The invention further protects an ilvLXGMEDA operon gene with feedback derepression, wherein the ilvLXGMEDA operon gene is obtained by removing 1st-n4th positions counting from the first position of the ilv attenuator from the ilvLXGMEDA operon gene. The invention further protects a method for feedback derepression of an ilvLXGMEDA operon in microorganisms. The method comprises the following step: deleting the 1st-n4th positions counting from the first position of the ilv attenuator. With adoption of the scheme, output of isoleucine and isoleucine derivatives can be increased remarkably, and great important application and promotion values are provided for the field of production of isoleucine and isoleucine derivatives.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an engineering bacterium based on an ilv attenuator and its application in producing isoleucine. Background technique [0002] L-isoleucine is one of the eight essential amino acids for the human body, and it is collectively referred to as branched-chain amino acids together with leucine and valine. Due to its special structure and function, L-isoleucine plays an important role in the metabolism of human and animal life, and participates in the synthesis of hormones and enzymes. At present, L-isoleucine is mainly used as an additive for feed and functional beverages. In addition, L-isoleucine is also widely used in biomedicine, food industry, cosmetics and other fields, and new uses are constantly being discovered, which greatly increases the market demand. At present, the main method of industrial production of L-isoleucine at home and abroad is microbial fermentation....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/63C12N1/21C12P13/06C12R1/19
CPCC12N15/113C12N2310/10C12P13/06
Inventor温廷益刘树文肖海涵孙建建张芸商秀玲
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI