A modified plasmid replicator and its application

A replicon and plasmid technology, applied in the field of bioengineering, can solve the problems of inability to express different genes, limit the diversity of plasmid construction, and the same type of high-copy replicon plasmids cannot exist at the same time, so as to solve the problems of plasmid incompatibility, Applicable effects

Active Publication Date: 2020-09-22
NANJING GENSCRIPT BIOTECH CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Due to the fact that there are very few high-copy replicons that have been found so far, most of the high-copy plasmids can only be constructed using CorEI / pMB1 / pBR322 type plasmid replicons, which greatly limits the diversity of plasmid construction. Therefore, looking for new The high-copy replicons of
At the same time, plasmids with the same type of high-copy replicons cannot exist in one cell at the same time, which makes it impossible for us to use two high-copy plasmids with CorEI / pMB1 / pBR322 replicons to express in the same E. coli cell at the same time different genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A modified plasmid replicator and its application
  • A modified plasmid replicator and its application
  • A modified plasmid replicator and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: In vitro transformation and screening of pSC101-RepA-E93P high-copy replicons

[0023] The purpose of this experiment is to obtain a high copy pSC101-RepA-E93P mutant. The steps are as follows:

[0024] 1) Sequence (SEQ ID NO.1) of the reported wild-type pSC101 replicon (Cohen et al.1973 Proc Natl Acad Sci USA; Cohen et al.1977J Bacteriol; Vocke C and Bastia D.1983Proc Natl Acad SciUSA) On the basis, the plasmid pGENT1 with the wild-type replicon was synthesized (it has the pSC101-RepA wild-type replicon, Kan resistance and LacZ selection markers, and its map is shown in figure 2 ; its sequence is shown in SEQ ID NO.3), the primers designed for the saturation mutation at the E93 position of RepA protein, wherein the F primer is: gtccactggaaaat nnn aaagcctttaaccaaaggattcctgatt; R primer is: attttccagtggacaaactatgccaagttctcaagcgaaaaatta, wherein n is a degenerate nucleotide selected from any one of a, c, t, and g. This primer was synthesized at GenScript C...

Embodiment 2

[0036] Example 2: Co-transformation of the plasmid pGENTS carrying the pSC101-RepA-E93P high-copy replicon and the plasmid pUC57 carrying the CorEI / pMB1 / pBR322 high-copy replicon

[0037] 1) Simultaneously transform pGENTS and pUC57 into Escherichia coli Top10, coat LB (Kan resistance + Amp resistance) plates, and culture overnight at 37°C.

[0038] 2) Pick a single clone from the transformation plate of Escherichia coli co-transformed with pGENTS and pUC57 plasmids, inoculate into LB liquid medium, and culture overnight at 37°C.

[0039] 3) From the culture in step 2), take 1ml of bacteria (OD 600 Equilibrate to ~1.5 to ensure that the amount of bacteria taken is the same), and use the Axygen (USA) plasmid mini-extraction kit to extract the plasmid.

[0040] 4) The plasmid obtained in step 3) was digested and linearized with EcoRI, and the ratio of pUC57 and pGENTS in E. coli was analyzed using an Agilent 2100 bioanalyzer.

[0041] Result: if Figure 5 As shown, both pGENT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a modified plasmid replicon and application thereof. The modified plasmid replicon is a mutant of a classic low-copy replicon pSC101 with the 93rd glutamic acid of RepA protein mutating into proline, and the codon encoding the proline is CCG. Plasmids carrying the artificially-modified plasmid replicon (pSC101-RepA-E93P), after being replicated in escherichia coli, can achieve an in-vitro extraction yield, which is about 12 times of that of plasmids carrying a wild type replicon of pSC101 and about twice of that of plasmids of pUC57 carrying CorEI / pMB1 / pBR322-type high-copy replicons. Meanwhile, in the Escherichia coli, the plasmids carrying the modified plasmid replicon can achieve replication almost at the same proportion with the plasmids carrying the CorEI / pMB1 / pBR322-type high-copy replicons.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to a transformed plasmid replicator and its application. [0002] technical background [0003] Plasmids are small DNA molecules that can replicate independently of chromosomes in cells. It is an essential functional carrier for the engineering transformation of animals, plants and bacteria. Plasmids can carry exogenous or artificially synthesized genes into animal, plant, and bacterial cells to achieve functional transformation of host cells. Plasmids have important application value in the fields of molecular biology, genetic engineering, synthetic biology and DNA therapy. [0004] The replication of plasmids in host cells depends on a special DNA element: the plasmid replicon. Currently common types of E. coli plasmid replicons include pSC101, p15A, R6K, CorEI / pMB1 / pBR322 and so on. Plasmids with different types of replicons usually have different copies, ranging from a few to th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/31C12N15/70C12R1/19
CPCC07K14/245C12N15/70
Inventor黄小罗王贞贞张丽华柳振宇
OwnerNANJING GENSCRIPT BIOTECH CO LTD