Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria

A technology of fusion protein and protein, which is applied in the field of fusion protein and can solve problems such as low survival rate

Pending Publication Date: 2017-09-26
SPOGEN BIOTECH INC
View PDF14 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, earlier efforts to introduce peptides, enzymes, and other proteins into soil to induce such beneficial effects on plants have been hampered by the low survival rates of enzymes, proteins, and peptides in soil
In addition, the prevalence of proteases naturally present in soil leads to the degradation of proteins in soil

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
  • Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
  • Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[1095] Example 1. Stimulation of Plant Growth in Soybean Using Recombinant Bacillus cereus Family Members Presenting Lipase or Endoglucanase

[1096] The Bacillus subtilis lipase and endoglucanase genes were amplified via polymerase chain reaction (PCR) using the following primers as shown in Table 16 below:

[1097] Table 16

[1098]

[1099] To generate the fusion construct, the native bclA promoter of Bacillus thuringiensis DNA encoding the first 35 amino acids of BclA (amino acids 1-35 of SEQ ID NO: 1 ) was fused to the gene by splicing by overlap extension (SOE) technique. Correct amplicons were cloned into the E. coli / Bacillus shuttle vector pHP13, and correct clones were screened by DNA sequencing. Correct clones were electroporated into Bacillus thuringiensis (Cry-, plasmid-) and screened for chloramphenicol resistance. Correct transformants were grown overnight at 30°C in brain heart infusion broth, plated on nutrient agar plates, and incubated at 30°C for 3 days...

Embodiment 2

[1105] Example 2. Stimulation of Plant Growth in Maize Using Recombinant Bacillus cereus Family Members Presenting Endoglucanases

[1106] BEMD spores expressing endoglucanase were produced in the same manner as described in Example 1 above. Non-sweet corn was planted to a depth of 3.8 cm in 10 cm deep pots filled with standard loam topsoil. Dilute control spores and BEMD spores expressing endoglucanase to 1 × 10 in 50 ml of water 4 per ml and applied to each plant at planting. A water only control was also included. Plants were grown under ideal light using T5 lamps (54 watts) and exposed to 11 hours of light / day under controlled temperature conditions between 15.5-25.5°C. The plants were watered to saturation every 3 days during the one week trial. At the end of one week, the height of each plant was measured and the measurements were normalized to control B. thuringiensis spores.

[1107] The results are shown in Table 18 along with the standard error of the mean. Mai...

Embodiment 3

[1110] Example 3. Stimulation of plant growth in wheat using recombinant Bacillus cereus family members displaying endoglucanases or proteases

[1111] BEMD spores expressing endoglucanase were formed in the same manner as described in Example 1 above. BEMD spores expressing the E. coli protease PtrB were generated using a method similar to that described above in Example 1 and the following primers: ggatccatgctaccaaaagcc (forward, SEQ ID NO: 41) and ggatccttagtccgcaggcgtagc (reverse, SEQ ID NO: 42).

[1112] Winter durum wheat was planted to a depth of 2.54 cm in 10 cm deep pots filled with standard loam topsoil. Dilute control spores and BEMD spores expressing endoglucanase or protease to 1 × 10 in 50 ml of water 4 per ml and applied to each plant at planting. A water only control was also included. Plants were grown under ideal light using T5 lamps (54 watts) and exposed to 11 hours of light / day under controlled temperature conditions between 15.5-25.5°C. The plants wer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

Fusion proteins containing a targeting sequence, an exosporium protein, or an exosporium protein fragment that targets the fusion protein to the exosporium of a Bacillus cereus family member are provided. Recombinant Bacillus cereus family members expressing such fusion proteins are also provided. Genetically inactivated Bacillus cereus family members and recombinant Bacillus cereus family members that overexpress exosporium proteins are also provided. Seeds coated with the recombinant Bacillus cereus family members and methods for using the recombinant Bacillus cereus family members (e.g., for stimulating plant growth) are also provided. Various modifiations of the recombinant Bacillus cereus family members that express the fusion proteins are further provided. Fusion proteins comprising a spore coat protein and a protein or peptide of interest, recombinant bacteria that express such fusion proteins, seeds coated with such recombinant bacteria, and methods for using such recombinant bacteria (e.g., for stimulating plant growth) are also provided.

Description

[0001] Cross-references to related applications [0002] This application claims the benefit of U.S. Provisional Patent Application Serial No. 62 / 051,885, filed September 17, 2014, which is incorporated by reference in its entirety. [0003] Reference to Electronically Submitted Sequence Listing [0004] An official copy of the sequence listing is submitted electronically via EFS-Web as a sequence listing in ASCII format with the file name "3005.WO gene sequence listing.txt" and a file name of "3005.WO gene sequence listing.txt" with a size of 488 kilobytes and submitted at the same time as the specification. The Sequence Listing contained in this ASCII format document is part of the specification, the entire contents of which are incorporated herein by reference. Technical field [0005] The present invention generally relates to fusion proteins containing targeting sequences, exosporium proteins or exosporium protein fragments that target the fusion proteins to the exospor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C07K19/00C12N15/75C12P21/02A01N37/44A01N63/02A23K20/147C09K8/62C12N3/00C12R1/085A01N63/50
CPCA23K20/147A01N37/44C07K14/32C09K8/62C12N3/00C12N15/75C12P21/02A23K10/18C07K2319/40C07K2319/01C07K2319/035C09K2208/24A01N63/50A61K39/00A01N63/22C12N1/20C12N15/62C02F3/348C02F2103/002C02F2103/003C02F2103/007C02F2103/06C02F2103/10C02F2103/14C02F2103/16C02F2103/26C02F2103/28C02F2101/10C02F2101/30A01N63/10C02F3/342A61L2/18E21B43/16A01H3/00A01N63/20
Inventor B·汤普森A·西格尔
Owner SPOGEN BIOTECH INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com