Method for achieving site-specific integration of multiple long-segment DNAs in mammalian cell by using ZFN

A mammalian, site-specific integration technology, applied in the field of genetic engineering, can solve the problems of small exogenous DNA fragments, low efficiency of double-crossover homologous recombination, unfavorable physical distance for homologous recombination exchange, etc., and achieve high efficiency.

Active Publication Date: 2017-09-29
SUN YAT SEN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this technology has the following disadvantages: only a single exogenous DNA fragment can be integrated into the genome. In addition, the efficiency of double crossover homologous recombination is generally low, generally 10 -6 ; The exogenous DNA fragments that use this technology to achieve site-specific integration are relatively small, generally less than 2kb
The specific reason may be that the greater the physical distance between the two homology arms, the less favorable the occurrence of simultaneous homologous recombination exchange on both sides of the target gene.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for achieving site-specific integration of multiple long-segment DNAs in mammalian cell by using ZFN
  • Method for achieving site-specific integration of multiple long-segment DNAs in mammalian cell by using ZFN
  • Method for achieving site-specific integration of multiple long-segment DNAs in mammalian cell by using ZFN

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1. Selection of CCR5 gene target site: According to the CCR5 gene sequence and the basic design principles of ZFN, design a ZFN targeting the human CCR5 gene. The specific sequence is shown in Table 1.

[0036] Table 1. Sequence information of ZFNs targeting CCR5 gene

[0037] name

Sequence (5'to 3')

ZFN targeting site

GTCATCCTCATCCTGATAAACTGCAAAAG

[0038] 2. HEK293T cell culture and transfection: HEK293T cell culture uses DMEM high-glucose medium with 10% fetal bovine serum, and the cells are cultured in about 1×10 5 Cells / mL were inoculated in 24-well cell culture plates for use. When the confluence of the cells reaches about 90%, it can be used for transfection. For transfection, 150ng of CCR5-ZFN-L plasmid, 150ng of CCR5-ZFN-R plasmid, 100ng of CCR5-EGFP-Donor plasmid (pEGFP-CCR5-HR), 1μL Lipofectamine 3000, 1μLP3000TM and 50μL Opti-MEM medium were added for transfection, and a single-transfection CCR5-EGFP-Donor plasmid treatment gro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for achieving site-specific integration of multiple long-segment DNAs in a mammalian cell by using ZFN. The method comprises the following steps: (1) constructing a gene CCR5-targeted single-crossing-over ZFN targeting system, wherein the single-crossing-over ZFN targeting system comprises left and right ZFN expression vectors aiming at a cut target point and a plurality of targeting donors employing different fluorescence labels; designing of each targeting donor comprises designing a promoter, a fluorescence labeled gene, left and right homologous arms of a target gene and a ZFN targeting locus at a joint of the left and right homologous arms; (2) carrying out cotransfection on the mammalian cell by using the ZFN targeting system, and then, carrying out flow-type sorting on a cell which stably expresses fluorescence; (3) carrying out PCR detection and sequencing identification on the cells sorted in the step (2), so as to achieve the sequential site-specific orientated insertion of multiple DNA long segments in the mammalian cell. According to the method, the site-specific orientated integration of multiple long-segment DNAs of 6kb or more in the mammalian cell can be achieved.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for realizing site-specific integration of multiple large fragments of DNA in mammalian cells by using ZFN. Background technique [0002] The site-directed integration of large fragments of foreign genes in mammalian cell genomes usually adopts the method of double crossover homologous recombination. The implementation steps of this technology are to construct a targeting donor containing two homology arms on both sides of the target gene , using two homologous arms to perform double-crossover homologous recombination with the target gene, thereby replacing the target gene with an exogenous DNA fragment between the two homologous arms. However, this technology has the following disadvantages: only a single exogenous DNA fragment can be integrated into the genome. In addition, the efficiency of double crossover homologous recombination is generally low, genera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90
CPCC12N15/907C12N2800/80
Inventor何祖勇黄翔刘小凤刘小红陈瑶生
OwnerSUN YAT SEN UNIV