Method for achieving site-specific integration of multiple long-segment DNAs in mammalian cell by using ZFN
A mammalian, site-specific integration technology, applied in the field of genetic engineering, can solve the problems of small exogenous DNA fragments, low efficiency of double-crossover homologous recombination, unfavorable physical distance for homologous recombination exchange, etc., and achieve high efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] 1. Selection of CCR5 gene target site: According to the CCR5 gene sequence and the basic design principles of ZFN, design a ZFN targeting the human CCR5 gene. The specific sequence is shown in Table 1.
[0036] Table 1. Sequence information of ZFNs targeting CCR5 gene
[0037] name
Sequence (5'to 3')
ZFN targeting site
GTCATCCTCATCCTGATAAACTGCAAAAG
[0038] 2. HEK293T cell culture and transfection: HEK293T cell culture uses DMEM high-glucose medium with 10% fetal bovine serum, and the cells are cultured in about 1×10 5 Cells / mL were inoculated in 24-well cell culture plates for use. When the confluence of the cells reaches about 90%, it can be used for transfection. For transfection, 150ng of CCR5-ZFN-L plasmid, 150ng of CCR5-ZFN-R plasmid, 100ng of CCR5-EGFP-Donor plasmid (pEGFP-CCR5-HR), 1μL Lipofectamine 3000, 1μLP3000TM and 50μL Opti-MEM medium were added for transfection, and a single-transfection CCR5-EGFP-Donor plasmid treatment gro...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


