196 results about "Chemokine receptor CCR5" patented technology

The invention relates to chimeric molecules comprising a virus coat sequence and a receptor sequence that can interact with each other to form a complex that is capable of binding a co-receptor. Such chimeric molecules therefore exhibit functional properties characteristic of a receptor-coat protein complex and are useful as agents that inhibit virus infection of cells due to occupancy of co-receptor present on the cell, for example. In particular aspects, the chimeric polypeptide includes an immunodeficiency virus envelope polypeptide, such as that of HIV, SIV, FIV, FeLV, FPV and herpes virus. Receptor sequences suitable for use in a chimeric polypeptide include, for example, CCR5 and CXCR4 sequences.

Methods are provided for efficient, high throughput screening of antibody libraries against proteins targets, especially membrane proteins. In particular, methods are provided for screening a fully human antibody library against membrane proteins such as HIV coreceptors in yeast. More particularly, a library of human single chain antibodies is screened against peptide fragments derived from extracellular domains of human CCR5 and high affinity monoclonal antibodies against CCR5 are selected.

The invention belongs to the field of gene engineering, and particularly relates to a method for specifically knocking out CCR5 genes of human bodies through CRISPR/SaCas9 and sgRNA used for specifically targeting CCR5 genes. The invention provides the method for specifically knocking out the CCR5 genes of the human bodies through CRISPR/SaCas9 and sgRNA used for specifically targeting the CCR5 genes and relates to a CRISPR/SaCas9 recombinant lentivirus and adeno-associated virus vector system and application. CRISPR/SaCas9 recombinant lentivirus and adeno-associated virus vectors can express SaCas9-RNA aiming at the CCR5 target spot of one same gene of the human bodies and rhesus monkeys, therefore, the application range is wider, and the efficiency is higher. The preparation method is easy to construct, the targeting efficiency is high, and a novel technology is provided for the gene therapy of HIV.

The invention belongs to the field of gene engineering and discloses a target sequence identified by a CRISPR-Cas9 system from neisseria meningitidis. The target sequence is as shown in the nth-24th sites of optional one of SEQ ID No. 1-20, and n=1-9. The invention further discloses sgRNA and coding DNA molecules thereof, the sequence of the sgRNA is 5'-identificiation sequence-sequence recruiting Cas9 protein-3', and the DNA sequence corresponding to the identification sequence is identical with the target sequence. The invention also discloses the CRISPR-Cas9 system which comprises the Cas9 protein, the sgRNA and/or a coding sequence carrying the Cas9 protein and a vector of the coding sequence of the sgRNA. The invention also discloses application of the CRISPR-Cas9 system to editing of CCR5 genes and preparation of medicine for HIV infection. By the CRISPR-Cas9 system, the CCR5 genes can be edited, and cells cannot be infected by HIV.

The present invention relates to editing the sgRNA sequence of CCR5 gene by using CRISPR technology and its application. The present invention provides an sgRNA sequence for the CCR5 gene, wherein the sgRNA sequence is selected from: CCR5-sgRNA1: AGGGCAACTAAATACATTCT, CCR5-sgRNA2: TGCCAAAAAATCAATGTGAA, CCR5-sgRNA3: AGTGGGACTTTGGAAATACA, and CCR5-sgRNA4: ATGCACAGGGTGGAACAAGA. The present invention also relates to a DNA sequence encoding the sgRNA sequence, a vector comprising the sgRNA sequence or the DNA sequence, a cell comprising the vector and uses thereof. The invention provides a safe and efficient sgRNA, which has the advantages of high cutting efficiency and low off-target probability, and has broad prospects in clinical research and application of AIDS gene therapy.

The invention discloses a method for constructing a mouse model for conditional knockout of CCR5 gene of endothelial cell. The method comprises the following steps of firstly, obtaining a CCR5loxp/loxp mouse, and mating with a Tie-2-cre/ERT2 mouse, so as to obtain heterozygous mice with specific knockout of CCR5 gene of the endothelial cell; mutually mating the heterozygous mice, so as to obtain homozygous mice with specific knockout of CCR5 gene out of the endothelial cell. The constructing method disclosed by the invention has the advantages that the mouse with conditional knockout of endothelial cell gene is constructed via the CRISPR/Cas9 system, the mutation is led into the mouse by a cell specificity method, the missing of the CCR5 target gene occurs at the certain tissue organ of the test animal, the controllability of mechanism study is furthest realized, and the disadvantages that different tissues or cells are not distinguished, and target genes in all tissues or cells of themouse body are all removed in the conventional gene knockout technique is overcome.

This method provides a method for reducing HIV-1 viral load in an HIV-1-infected human subject which comprises administering to the subject at a predefined interval effective HIV-1 viral load-reducing doses of (a) a humanized antibody designated PRO 140, or of (b) an anti-CCR5 receptor monoclonal antibody. This invention also provides a method for inhibiting in a human subject the onset or progression of an HIV-1-associated disorder, the inhibition of which is effected by inhibiting fusion of HIV-1 to CCR5⁺CD4⁺ target cells in the subject. This invention also provides a method for treating a subject infected with HIV-1 comprising administering to the subject (a) a monoclonal antibody which (i) binds to a CCR5 receptor on the surface of the subject's CD4⁺ cells and (ii) inhibits fusion of HIV-1 to the subject's CCR5⁺CD4+ cells, and (b) a non-antibody CCR5 receptor antagonist, in amounts effective to treat the subject.

The invention provides a method for finishing down producing goat VEGF gene fixed-point knock-in mediated by a CRISPR/Cas9 system. The method comprises the following steps: establishing a gRNA expression vector and a VEGF homologous recombination vector on the basis of the CRISPR/Cas9 system according to a CCR5 gene sequence of down producing goats; then jointly transferring three optimized vectors into fibroblasts of down producing goat fetuses to obtain VEGF gene fixed-point knocked-in positive cells; and preparing VEGF gene fixed-point integrated down producing goats by using a somatic nuclear transfer technology. The established targeting vector based on the CRISPR/Cas9 system provides a simple, rapid and safe path for fixed-point knock-in of goat VEGF genes. The method does not involve any screening marker genes in a cell line screening process, therefore, the safety of transgenic animals is greatly improved, and the method has high value on research of genetic breeding and gene functions of down producing goats.

The invention employs a CRISPR-Cas9 system to complete mediation of a goat Tbeta4 gene for site-directed knock-in. A gRNA expression vector and a Tbeta 4 homologous recombinant vector based on the CRISPR-Cas9 system are constructed according to a CCR5 gene sequence of the goat. An optimized CRISPR-Cas9 vector and a constructed gRNA expression vector and the Tbeta 4 homologous recombinant vector are transferred to skeletal muscle satellite cells together, in order to obtain cells with the site-directed Tbeta4 gene. A targeting vector constructed based on the CRISPR-Cas9 system provides a simple, fast and safe pathway for site-directed knock-in of the goat Tbeta4 gene. Any screening marker genes are not related in a cell line screening process, safety of transgenic animals is greatly improved, and the method has important value for genetic breeding of goats and research of gene function.

The invention discloses a CRISPR (clustered regularly interspaced short palindromic repeat)/Cas9 recombinant lentiviral vector containing gRNA sequence specifically targeting CCR5 and application thereof. A lentivirus of the CRISPR/Cas9 recombinant lentiviral vector containing gRNA sequence specifically targeting CCR5 gene Delta 32 region is constructed that the lentivirus can introduce cells into a CRISPR/Cas9 system specific to CCR5, double-chain breakage occurs to a specific site of CCR5 gene, a random mutation is introduced to a breakage site after repairing by means of nonhomogeneous recombinant terminal binding, and the mutation rate reaches 90% and above. As gRNA is a nonhomogeneous region of CCR5 and CCR2, detection shows that the missing efficiency of the two gRNAs is lower than 0.2%. Cells modified via the recombinant lentivirus have significantly decreased efficiency of HIV (human immunodeficiency virus) infection. The system is quick to construct, simple and low in price, and is applicable to gene therapy of acquired immune deficiency syndrome.

The invention relates to a combination of treatments, more particularly a combination treatment for HIV-1 infection. The present invention is directed to the use of bryostatin-1 and their natural and synthetic derivatives for AIDS therapy, in particular to the use of bryostatins in combination with other active drugs such as Histone Deacetylases (HDACs) inhibitors and anti-retrovirals, for the treatment of HIV-1 latency. According to the present invention, we provide a combination therapy for the treatment of HIV-1 latency which employs bryostatin-1 (and analogues) and one of the following HDAC inhibitors; valproic acid, butyrate derivatives, hydroxamic acids and benzamides. While HDACi can be used in continuous dosing protocol, bryostatins can be used following a cyclical dosing protocol. Bryostatins can be formulated in pharmaceutical acceptable carriers including nanoparticles, phospholipids nanosomes and/or biodegradable polymer nanospheres. This combination therapy needs to be used in patients treated with antiretroviral therapy (HIV-1 protease inhibitors, HIV-1 reverse transcriptase inhibitors, HIV-1 integrase inhibitors, CCR5 co-receptor inhibitors and fusion inhibitors).

The present invention features antibodies and antibody fragments that specifically bind a CD4-inducible HIV gp120 epitope that is enhanced by binding a co-receptor for HIV, such as CCR5 or CXCR4, and pharmaceutical compositions comprising the antibodies or antibody fragments. The invention also features nucleic acids encoding the antibodies or antibody fragments, pharmaceutical compositions comprising the nucleic acids encoding the antibodies or antibody fragments, vectors comprising the nucleic acids, and cells comprising the vectors. The invention further features methods of identifying antibodies or antibody fragments with broadly neutralizing activity against HIV. The invention also features methods of inhibiting HIV entry into cells and methods of inhibiting replication of HIV in mammals, using the antibodies and nucleic acids of the invention.

The present invention relates to the downregulation of surface receptor CCR5 expression through manipulation of the cell cycle in activated lymphocytes by administering a composition that arrests the G1 phase of the cell cycle, thereby reducing receptor sites for entry of HIV into T cells, and thus, the effects of HIV. Further, compositions are disclosed that include at least one G1 phase arresting agent and at least one antiviral agent, wherein the combination of agents synergistically enhances the activity of the antiviral agent.

Chemokine receptor antagonists, in particular, 3,7-diazabicyclo[3.3.0]octane compounds according to formula (I) are antagonists of chemokine CCR5 receptors which are useful for treating or preventing an human immunodeficiency virus (HIV) infection, or treating AIDS or ARC. The invention further provides methods for treating diseases that are allieviated with CCR5 antagonists. The invention includes pharmaceutical compositions and methods of using the compounds for the treatment of these diseases. The invention further includes processes for the preparation of compounds according to formula I.

Compositions are provided that comprise antibody against coreceptors for human immunodeficiency virus such as CCR5 and CXCR4. In particular, monoclonal human antibodies against human CCR5 are provided that bind to CCR5 with high affinity and are capable of inhibiting HIV infection at low concentrations. The antibodies can be used as prophylactics or therapeutics to prevent and treat HIV infection, for screening drugs, and for diagnosing diseases or conditions associated with interactions with HIV coreceptors.

The invention relates to an immunogen comprising an HIV envelope protein bound to a ligand, which ligand upregulates at least one of the CD4 binding site and the CCR5 binding site on the protein, and bound to an HR-2 peptide. The invention also relates to a method of inducing anti-HIV antibodies using such an immunogen.

A method of treating viral infections, particularly Hepatitis B (HBV) and Human Immunodeficiency Virus (HIV) infections, by administering Elvucitabine and a second active agent to a patient suffering viral infection is provided herein. The second active agent is, for example, an immunomodulatory compound, an anti-viral agent, or a combination comprising one or more of the foregoing active agents. For example the anti-viral agent may be a tyrosine kinase inhibitor, a CCR5 inhibitor, a non-nucleoside reverse transcriptase inhibitor, a protease inhibitor, an integrase inhibitor. Further provided herein are combination dosage forms comprising Elvucitabine and a second active agent. The combination dosage may be administered once per day. The Elvucitabine may be administered less frequently than the second active agent. Packaged pharmaceutical compositions comprising Elvucitabine, a second active agent, and instructions for using the composition for treating a viral infection by administering Elvucitabine and the second active agent are also provided.

Soluble molecules are provided. Thus, for example, provided is a soluble molecule which comprises a heterologous amino acid sequence conjugated to a CCR5 amino acid sequence being capable of binding a CCR5 ligand, and wherein the molecule is devoid of an N-terminus domain of CCR5. Also provided are pharmaceutical compositions which comprise the above molecules and methods and uses of same.

A composition including a CXCR4 antagonist and a CCR5 antagonist represented by formula I or II:

or an acceptable salt, solvate or ester thereof. The CXCR4 antagonist includes at least one of AMD-070, CS-3955, KRH-1120, KRH-2731, and KRH-1636.

The present invention provides a new cyclic compound having a CCR antagonist activity, especially a CCR5 antagonist activity, and the use thereof. The compound of the present invention is represented by the formula: wherein, R<1 >is a 5- to 6-membered ring group which may be substituted; X<1 >is a bond or the like; ring A is a 5- to 6-membered ring group which may be substituted; ring B is a 8- to 10-membered ring group which may be substituted; X<2 >is a bivalent group of 1 to 4 atoms; Z<1 >is a bivalent cyclic ring group or the like; Z<2 >is a bond or the like; and R<2 >is an amino group, a nitrogen-containing heterocyclic group which may be substituted or the like, or a salt thereof.

The present invention provides modified erythrocytes which comprise viral receptor proteins capable of mediating entry of respective viruses into the modified erythrocytes. The present invention also provides methods of using the modified erythrocytes for the treatment or prevention of viral infections. In one embodiment, the modified erythrocytes of the present invention comprise CD4 and at least one HIV coreceptor, such as CXCR4 or CCR5. The modified erythrocytes, when administered to an HIV patient, bind to the plasma virus and induce the injection of the HIV ribonucleoprotein complex into the cells. The entrapped viral content is either degraded or deactivated within the erythrocytes, or destroyed by erythrophagocytosis.