Unlock instant, AI-driven research and patent intelligence for your innovation.

Sgrna (ribonucleic acid) sequence for editing ccr5 gene by crispr (clustered regularly interspaced short palindromic repeats) technology and application thereof

A DNA sequence, ccr5-sgrna2 technology, applied in DNA/RNA fragments, genetic engineering, recombinant DNA technology, etc., can solve problems such as non-homologous end joining insertion or deletion errors, and achieve high cutting efficiency and low off-target probability Effect

Inactive Publication Date: 2017-09-19
PEKING UNIV
View PDF0 Cites 35 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Non-homologous end joining (NHEJ) can cause insertion or deletion errors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sgrna (ribonucleic acid) sequence for editing ccr5 gene by crispr (clustered regularly interspaced short palindromic repeats) technology and application thereof
  • Sgrna (ribonucleic acid) sequence for editing ccr5 gene by crispr (clustered regularly interspaced short palindromic repeats) technology and application thereof
  • Sgrna (ribonucleic acid) sequence for editing ccr5 gene by crispr (clustered regularly interspaced short palindromic repeats) technology and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] The present invention will now be described more fully with reference to the accompanying drawings, in which some, but not all embodiments of the invention are depicted. Indeed, these inventions may be embodied in many different forms and should not be construed as limited to the embodiments shown herein as modifications and other embodiments are intended to be included within the scope of the appended claims.

[0021] 1. sgRNA

[0022] In general, a sgRNA is any polynucleotide sequence that is sufficiently complementary to a target polynucleotide sequence to hybridize to the target sequence and direct specific binding of the CRISPR complex to the target sequence.

[0023] In some embodiments, the sgRNA of the present invention can be further modified so that the modified sgRNA has the same sequence as listed above CCR5-sgRNA1: AGGGCAACTAAATACATTCT, CCR5-sgRNA2: TGCCAAAAAATCAATGTGAA, CCR5-sgRNA3: AGTGGGACTTTGGAAATACA, and CCR5-sgRNA4: ATGCACAGGGTGGAACAAGA has about 100...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to editing the sgRNA sequence of CCR5 gene by using CRISPR technology and its application. The present invention provides an sgRNA sequence for the CCR5 gene, wherein the sgRNA sequence is selected from: CCR5-sgRNA1: AGGGCAACTAAATACATTCT, CCR5-sgRNA2: TGCCAAAAAATCAATGTGAA, CCR5-sgRNA3: AGTGGGACTTTGGAAATACA, and CCR5-sgRNA4: ATGCACAGGGTGGAACAAGA. The present invention also relates to a DNA sequence encoding the sgRNA sequence, a vector comprising the sgRNA sequence or the DNA sequence, a cell comprising the vector and uses thereof. The invention provides a safe and efficient sgRNA, which has the advantages of high cutting efficiency and low off-target probability, and has broad prospects in clinical research and application of AIDS gene therapy.

Description

technical field [0001] The present invention relates to the fields of biotechnology and gene therapy, and in particular to the sgRNA sequence for targeted knockout of CCR5 gene and treatment of AIDS by using CRISPR system and its application. Background technique [0002] The CRISPR / Cas system is an adaptive immune defense mechanism used by bacteria and archaea for the degradation of exogenous genetic material. In these organisms, foreign genetic material from phages is acquired and integrated into CRISPR sites. This new material, also called a spacer, establishes a segment for future sequence specificity of phage infectivity. These sequence-specific fragments are translated into CRISPR-guiding RNAs (sgRNAs), which function to complement invasive DNA cleavage via the nuclease activity of CRISPR-associated (Cas) proteins, directed by the CRISPR site code. The type II CRISPR system Cas9 nuclease has an RNA-binding domain, an α-helix recognition lobe (REC), a nucleic acid lob...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N5/10C12N15/85A61K31/7088A61P31/18
CPCC12N15/1132C07K14/47C12N15/85C12N2310/10C12N2800/107
Inventor 邓宏魁杨欢徐磊
Owner PEKING UNIV