Method for mediating site-directed knock-in of goat Tbeta4 gene based on CRISPR/Cas 9 technology

A goat and gene technology, applied in the fields of molecular biology and animal genetics and breeding, to achieve the effect of improving safety

Active Publication Date: 2018-01-05
INNER MONGOLIA UNIVERSITY
View PDF6 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The method of site-directed knock-in of goat Tβ4 gene using CRISPER-Cas9 system has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for mediating site-directed knock-in of goat Tbeta4 gene based on CRISPR/Cas 9 technology
  • Method for mediating site-directed knock-in of goat Tbeta4 gene based on CRISPR/Cas 9 technology
  • Method for mediating site-directed knock-in of goat Tbeta4 gene based on CRISPR/Cas 9 technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Optimization of CRISPER-Cas9 vector

[0036]Optimize the CRISPR-Cas9 expression vector purchased from Beijing Zhongyuan Company. The nucleotide sequence of the optimized CRISPER-Cas9 vector (i.e. hCas9 plasmid) is shown in SEQ ID NO: 1. The hCas9 plasmid map is shown in figure 1 .

Embodiment 2

[0037] Example 2 Construction of gRNA expression vector.

[0038] According to the goat CCR5 gene sequence (NC-022314.1), the gene sequence is shown in SEQ ID NO:2. A gRNA sequence was designed on the exon 2 sequence of the CCR5 gene, and a gRNA expression vector based on the CRISPER-Cas9 system was constructed. The gRNA expression vector includes four parts: U6 promoter, target sequence, gRNA backbone and termination signal. Based on the CRISPR-Cas9 system to mediate the goat Tβ4 gene site-specific knock-in pattern, see figure 2 . Wherein, the DNA sequence of the sgRNA action site is as follows: sgRNA1: 5'- TCGTGGGGGAGAAGTTCCGA -3'. Use biological software to design the sgRNA sequence according to the sgRNA action site, and use PrimeSTAR with gRNA-T2 as the template ® The fidelity enzyme was used to PCR amplify the U6 promoter part and the gRNA backbone carrier part. Finally, the whole PCR method was used to amplify the gRNA, and it was treated with A tail. After the tr...

Embodiment 3

[0039] Example 3 Transfection of goat fetal fibroblasts by electroporation.

[0040] The fetal fibroblasts were thawed in a 100mm culture dish. In order to restore the cells to a good state and vitality, the cells were passaged before transfection by electroporation. When the cells grow to 90%, wash with PBS, digest with 0.25% trypsin for 3 minutes, add DMEM / F12 culture medium containing 15% fetal bovine serum to terminate the digestion of the cells, blow repeatedly with a gun to avoid cell clumps, and place The cell suspension was added to a 10mL centrifuge tube, centrifuged at 1500rpm for 5min, and the supernatant was discarded. Resuspend the cells with 5mL Opti-MEM, centrifuge at 1500rpm for 5min, discard the supernatant, and repeat this process 3 times. Finally, cells were resuspended with Opti-MEM so that each 90 µL cell suspension contained 1×10 6 Fetal fibroblasts, take 90 µL of resuspension and add 10 µL of plasmid (5 µg of CRISPR / Cas9 circular plasmid, 5 µg of 455bp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention employs a CRISPR-Cas9 system to complete mediation of a goat Tbeta4 gene for site-directed knock-in. A gRNA expression vector and a Tbeta 4 homologous recombinant vector based on the CRISPR-Cas9 system are constructed according to a CCR5 gene sequence of the goat. An optimized CRISPR-Cas9 vector and a constructed gRNA expression vector and the Tbeta 4 homologous recombinant vector are transferred to skeletal muscle satellite cells together, in order to obtain cells with the site-directed Tbeta4 gene. A targeting vector constructed based on the CRISPR-Cas9 system provides a simple, fast and safe pathway for site-directed knock-in of the goat Tbeta4 gene. Any screening marker genes are not related in a cell line screening process, safety of transgenic animals is greatly improved, and the method has important value for genetic breeding of goats and research of gene function.

Description

technical field [0001] The invention relates to the fields of molecular biology and animal genetic breeding, in particular to a method for point-directed knock-in of goat Tβ4 gene mediated by CRISPER-Cas9 technology. Background technique [0002] CRISPR-Cas9, as a site-specific gene modification technology, has developed rapidly in recent years. The technology is based on Clustered regulatory interspaced short palindromic repeat (CRISPR) and Cas9 nuclease (CRISPR associated system9, Cas9), which is the acquired immune system existing in bacteria and archaea, through its transcription The product crRNA (CRISPR RNA) and CRISPR-associated protein (CRISPR-associated, Cas), especially the Cas9 protein, can effectively help bacteria resist the infection of foreign DNA. Based on this principle, the CRISPR-Cas9 system has been transformed into a third-generation gene editing technology. This technology is guided by a short small RNA to modify DNA, cut the double strand of DNA to cr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/87C12N5/10A01K67/027
Inventor李晓聪梁浩郝斐潘伟王志钢刘东军
OwnerINNER MONGOLIA UNIVERSITY