Sulfate reducing bacterium capable of achieving heavy metal settling and application of sulfate reducing bacterium

A heavy metal and sulfate technology, applied in the field of microorganisms, can solve the problems of poor heavy metal ion treatment capacity and less than 90% removal rate, and achieve the effect of good heavy metal sedimentation performance

Active Publication Date: 2017-10-24
LANZHOU UNIVERSITY
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Wang Hui et al. did a study on mixed sulfate-reducing bacteria and its treatment of heavy metal wastewater, showing that Cd 2+ When the initial ion content is greater than 10mg / L, the removal rate at the end of the reaction is less than 90%
In these studies, it is common that sulfate-reducing bacteria have poor ability to process some common heavy metal ions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sulfate reducing bacterium capable of achieving heavy metal settling and application of sulfate reducing bacterium
  • Sulfate reducing bacterium capable of achieving heavy metal settling and application of sulfate reducing bacterium
  • Sulfate reducing bacterium capable of achieving heavy metal settling and application of sulfate reducing bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Enrichment of sulfate-reducing bacteria from soil, waste water, and paddy fields

[0037] (1) Sample collection: When collecting soil samples, first dig out the surface soil, discard the upper surface soil, collect soil samples below 5cm of the soil surface, put the collected soil samples into a ziplock bag, and remove the air in the ziplock bag , to ensure the anaerobic environment required by sulfate-reducing bacteria. When collecting samples in wastewater and paddy fields, collect samples at the bottom of the wastewater and paddy fields, it is best to collect the wastewater and the water-mud mixture at the bottom of the paddy fields together, then put them into a bottle with a cover, fill the sample to the drain The air in the bottle ensures the anaerobic state required by sulfate reducing bacteria.

[0038] (2) Enrichment of samples: After processing the collected samples, take a little and put them into SRB liquid medium to enrich the bacteria. After 7-8...

Embodiment 2

[0043] The characteristic identification of embodiment 2 sulfate-reducing bacteria

[0044] (1) Cell morphology observation and staining reaction:

[0045] After inoculation of sulfate-reducing bacteria and constant temperature culture of solid medium for a suitable time, staining and microscopic examination.

[0046] Staining and microscopic examination results: Sulphate-reducing bacteria SRB-L (Desulfovibrio sp.SRB-L) is an arc-shaped (rod-shaped) bacterium, Gram-negative, and the length of the bacteria is about 1.5-3.5 μm.

[0047] (2) Identification of sulfate-reducing bacteria SRB-L (Desulfovibrio sp.SRB-L) by comparative analysis of 16s rDNA:

[0048] Amplification and sequencing primers:

[0049] Forward primer: TLHJ-F 5’—AGAGTTTGATCCTGGCTCAGA—3’

[0050] Reverse primer: TLHJ-R 5'—CAACTTCATGCAGTCGAGTTG—3'

[0051] Extract the total DNA of sulfate-reducing bacteria SRB-L (Desulfovibrio sp. Sequencing was performed, and the 16s rDNA gene sequence of the strain is sho...

Embodiment 3

[0053] Example 3 Sulfate-reducing bacteria SRB-L (Desulfovibrio sp.SRB-L) to the sedimentation performance of heavy metal ions (1) sulfate-reducing bacteria SRB-L (Desulfovibrio sp.SRB-L) to heavy metal ions Cu 2+ Settling performance

[0054] Prepare copper sulfate mother liquor, add 10% sulfate-reducing bacteria SRB-L (Desulfovibrio sp. Atomic Absorption Determination of Cu in Supernatant 2+ content.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Lengthaaaaaaaaaa
Login to View More

Abstract

The invention relates to a sulfate reducing bacterium capable of achieving heavy metal settling and an application of the sulfate reducing bacterium. The sulfate reducing bacterium is separated from a paddy field. The sulfate reducing bacterium is collected in China Center for Type Culture Collection on April 19, 2015, with a collection number of CCTCC NO (China Center for Type Culture Collection number): M2015243 and a name of the sulfate reducing bacterium SRB-L (desulfovibrio sp. SRB-L). The bacterium has good heavy metal settleability and can be used for removing heavy metal ions from soil and waste water.

Description

technical field [0001] The invention belongs to the field of microorganisms, and in particular relates to a sulfate-reducing bacterium SRB-L (Desulfovibrio sp. SRB-L) capable of sinking heavy metals and its application in removing heavy metal ions in water bodies. The bacteria has been preserved in the China Center for Type Culture Collection on April 19, 2015, address: China. Wuhan. Wuhan University, Zip Code: 430072, Tel: (027)68754052, Fax: (027)68754833, E-mail: cctcc@whu.edu.cn, its deposit number is CCTCC NO: M 2015243. Background technique [0002] Sulfate-reducing bacteria SRB (Sulfate-Reducing Bacteria.SRB) is a class of prokaryotic microorganisms that widely exist in nature. They use sulfate as an electron acceptor to consume organic acids and generate highly reactive sulfides. The SRB method uses natural The sulfur cycle principle is used to treat acid mine wastewater (AMD). This method achieves the reduction of SO through the metabolic characteristics of microor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C02F3/34B09C1/10C12R1/01C02F101/20
CPCB09C1/10C02F3/34C02F2101/20C12N1/205C12R2001/01
Inventor李红玉杨锐李洋赵晶戴治娟蒋云龙
OwnerLANZHOU UNIVERSITY