Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of fhl3 gene in promoting animal growth

A FHL3 and gene technology, applied in the field of animal transgenic, can solve the problems such as improving the growth rate and muscle mass of animals that have not been seen by transgenic FHL3 gene, and achieve the effect of high muscle yield and fast growth rate.

Active Publication Date: 2020-08-11
HUAZHONG AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] So far, there has been no report on the improvement of animal growth rate and muscle mass by transgenic FHL3

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of fhl3 gene in promoting animal growth
  • Application of fhl3 gene in promoting animal growth
  • Application of fhl3 gene in promoting animal growth

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Preparation of transgenic mice overexpressing the FHL3 gene:

[0039] 1.1pEGFP-N1L-MCK-FHL3 transgenic vector construction and linearization:

[0040] Total RNA of mouse C2C12 myoblast cell line was extracted, and cDNA was obtained after reverse transcription. Using the CDS sequence of the mouse FHL3 gene published in the NCBI database (Genebank accession number: NM-010213.3), primers containing Sal I and Not I restriction sites were designed:

[0041] FHL3-F1 GTCGACGCCACCATGAGCGAGGCATTTGAC

[0042] FHL3-R1 GCGGCCGCTCAGGGGCCTGCTTGGCTG

[0043] The CDS sequence of the FHL3 gene was obtained by ordinary PCR amplification, and the size was 890 bp. The CDS sequence was as follows:

[0044] GTCGACGCCACCATGAGCGAGGCATTTGACTGTGCAAAATGCAACGAGTCCTTGTACGGCCGCAAATACATCCAGACAGACAGTGGCCCCTACTGCGTTCCGTGCTATGACAACACCTTCGCCAACACCTGTGCTGAGTGCCAGCAGCTCATTGGGCATGATTCAAGGGAACTGTTCTATGAGGACCGCCACTTCCACGAGGGCTGCTTCCGCTGCTGCCGATGCCAGCGCTCCCTTGCCGATGAGCCCTTCACCTGTCAGGACAGTGAGCTTCTGTGTAATGAGT...

Embodiment 2

[0056] Application of FHL3 gene in promoting animal growth:

[0057] 1) The growth rate of the transgenic mice overexpressing the FHL3 gene is significantly faster than that of the wild type

[0058] After the F1 generation mice transfected with the FHL3 gene are paired with full siblings, the pregnancy status of the mice is regularly observed, and the frequency of inspection is increased when the mother mice are about to give birth. heavy and marked. At the same time, the supply of rat food and drinking water is sufficient, and the bedding is changed regularly to ensure a good living environment for the mice. After that, the body weight of each mouse was weighed again every week until the 8th week, and the recording of the weight gain of the mice was completed. During the period, all newborn mice were clipped at the age of 2 weeks for DNA extraction and PCR identification, weaned at the age of 3 weeks, and kept in separate cages with the female mice. There is enough room f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of animal transgenosis, and discloses application of FHL3 gene in promotion of animal growth. The FHL3 gene is over-expressed in animal bodies, and the growth rate and muscle content of animals can be obviously improved. The invention firstly discloses that the over-expression of the FHL3 gene can promote the growth of individuals and the increase of the muscle content, and firstly discovers the function of the FHL3 gene in the aspect. The invention indicates that the FHL3 gene can serve as a candidate gene for preparing transgenosis livestock with high growth rate and high muscle yield.

Description

technical field [0001] The invention belongs to the technical field of animal transgenic, and particularly relates to the application of FHL3 gene in promoting animal growth. Overexpression of FHL3 gene in animals can significantly improve the growth rate and muscle mass of animals. Background technique [0002] Animal husbandry is an integral part of agriculture and an important pillar of agricultural economy, and has an important position and role in the national economy. For farmers, using less input to obtain more output can significantly improve economic efficiency. In addition, the improvement of people's living standards also requires the consumption of more animal foods such as meat, eggs and milk. The improvement of livestock breeds by traditional breeding technology requires a lot of manpower and material resources, and the cycle is long and the effect is slow. The development and utilization of new genetic improvement technologies to improve the productivity of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12A01K67/027
CPCA01K67/0278A01K2207/15A01K2217/052A01K2267/02C07K14/4702
Inventor 左波徐在言许海洋
Owner HUAZHONG AGRI UNIV