Application of fhl3 gene in promoting animal growth
A FHL3 and gene technology, applied in the field of animal transgenic, can solve the problems such as improving the growth rate and muscle mass of animals that have not been seen by transgenic FHL3 gene, and achieve the effect of high muscle yield and fast growth rate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Preparation of transgenic mice overexpressing the FHL3 gene:
[0039] 1.1pEGFP-N1L-MCK-FHL3 transgenic vector construction and linearization:
[0040] Total RNA of mouse C2C12 myoblast cell line was extracted, and cDNA was obtained after reverse transcription. Using the CDS sequence of the mouse FHL3 gene published in the NCBI database (Genebank accession number: NM-010213.3), primers containing Sal I and Not I restriction sites were designed:
[0041] FHL3-F1 GTCGACGCCACCATGAGCGAGGCATTTGAC
[0042] FHL3-R1 GCGGCCGCTCAGGGGCCTGCTTGGCTG
[0043] The CDS sequence of the FHL3 gene was obtained by ordinary PCR amplification, and the size was 890 bp. The CDS sequence was as follows:
[0044] GTCGACGCCACCATGAGCGAGGCATTTGACTGTGCAAAATGCAACGAGTCCTTGTACGGCCGCAAATACATCCAGACAGACAGTGGCCCCTACTGCGTTCCGTGCTATGACAACACCTTCGCCAACACCTGTGCTGAGTGCCAGCAGCTCATTGGGCATGATTCAAGGGAACTGTTCTATGAGGACCGCCACTTCCACGAGGGCTGCTTCCGCTGCTGCCGATGCCAGCGCTCCCTTGCCGATGAGCCCTTCACCTGTCAGGACAGTGAGCTTCTGTGTAATGAGT...
Embodiment 2
[0056] Application of FHL3 gene in promoting animal growth:
[0057] 1) The growth rate of the transgenic mice overexpressing the FHL3 gene is significantly faster than that of the wild type
[0058] After the F1 generation mice transfected with the FHL3 gene are paired with full siblings, the pregnancy status of the mice is regularly observed, and the frequency of inspection is increased when the mother mice are about to give birth. heavy and marked. At the same time, the supply of rat food and drinking water is sufficient, and the bedding is changed regularly to ensure a good living environment for the mice. After that, the body weight of each mouse was weighed again every week until the 8th week, and the recording of the weight gain of the mice was completed. During the period, all newborn mice were clipped at the age of 2 weeks for DNA extraction and PCR identification, weaned at the age of 3 weeks, and kept in separate cages with the female mice. There is enough room f...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


