Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of recombinant human interferon alpha2b

A technology of recombinant human interferon and interferon alpha, applied in the field of interferon, can solve problems such as adverse reactions, affecting protein function and stability, looseness, etc., to reduce immunogenicity, reduce the incidence of adverse reactions, and promote correct pairing Effect

Pending Publication Date: 2017-11-24
ANHUI ANKE BIOTECHNOLOGY (GRP) CO LTD
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The slow band component can sometimes reach 50% of the total protein after renaturation, which is the most critical component affecting the quality of recombinant human interferon α2b, which affects the function and stability of the protein. Cys1-cys98 cannot be oxidized and paired, and will form Loose conformation, causing many clinical adverse reactions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of recombinant human interferon alpha2b
  • Preparation method of recombinant human interferon alpha2b
  • Preparation method of recombinant human interferon alpha2b

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0018] Below in conjunction with embodiment the present invention is described in detail.

[0019] (1) Construct the expression vector of recombinant human interferon α2b gene and transform it into competent cells:

[0020] (1.1) Design of PCR primers:

[0021] Design upstream and downstream primers P1 and P2 of human interferon α2b gene:

[0022] P1: GG CATATG TGTGATCTGCCTCAAACCCAC (the underline is the NdeⅠ restriction site)

[0023] P2: GG GGATCC TTATTCCTTACTTCTTAAACTTTC (the underline is the BamHI restriction site)

[0024] PCR amplification of human interferon α2b gene, the amplification system is as follows:

[0025]

[0026] The PCR reaction procedure includes:

[0027]

[0028]

[0029] The PCR product was separated by 1% agarose gel electrophoresis, and then the human interferon α2b gene fragment of the PCR product was recovered with an AxyPrep DNA Gel Recovery Kit (AXYGEN Company).

[0030] (1.2) Cut PCR recovery product and pJW2 with the same restr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of interferons and particularly relates to a preparation method of a recombinant human interferon alpha2b. The preparation method comprises the following steps: (1) constructing an expression vector of a recombinant human interferon alpha2b gene, and converting the expression vector into a competent cell; (2) constructing a recombinant plasmid of an escherichia coli disulfide bond isomerase C gene; (3) converting the recombinant plasmid into the competent cell, so as to obtain a double-plasmid recombinant expression strain; and (4) carrying out induced expression, renaturation and purification on the double-plasmid recombinant expression strain, so as to obtain the recombinant human interferon alpha2b. According to the preparation method of the recombinant human interferon alpha2b, the correct pairing of disulfide bonds cys1-cys98, so that a slow carrying component of the recombinant human interferon alpha2b is reduced, and furthermore, the stability and antiviral activity of the recombinant human interferon alpha2b are improved.

Description

technical field [0001] The invention relates to the technical field of interferon, in particular to a preparation method of recombinant human interferon α2b. Background technique [0002] Recombinant human interferon α2b is a kind of protein with broad-spectrum antiviral activity. It is mainly used clinically to treat viral diseases such as hepatitis B and hepatitis C, and is also used as a combination of some tumor chemotherapy drugs. In the production process of recombinant human interferon α2b, the active protein needs to be expressed, separated, denatured, and refolded. During the renaturation process, part of the disulfide bond cys1-cys98 in recombinant human interferon α2b is subject to a steric position The resistance can not be oxidized and paired, thus forming a loose conformation. On the oxidized SDS-PAGE protein gel electrophoresis, the swimming is slower, and the apparent molecular weight is larger than that of recombinant human interferon α2b paired with cys1-cy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/21C12N15/70C07K14/56
CPCC07K14/56C12N15/70
Inventor 李道远邹文艺赵伟李成彬黄伟朱武进宋礼华饶海军华晓君
Owner ANHUI ANKE BIOTECHNOLOGY (GRP) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com