Preparation method of recombinant human interferon alpha2b
A technology of recombinant human interferon and interferon alpha, applied in the field of interferon, can solve problems such as adverse reactions, affecting protein function and stability, looseness, etc., to reduce immunogenicity, reduce the incidence of adverse reactions, and promote correct pairing Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0018] Below in conjunction with embodiment the present invention is described in detail.
[0019] (1) Construct the expression vector of recombinant human interferon α2b gene and transform it into competent cells:
[0020] (1.1) Design of PCR primers:
[0021] Design upstream and downstream primers P1 and P2 of human interferon α2b gene:
[0022] P1: GG CATATG TGTGATCTGCCTCAAACCCAC (the underline is the NdeⅠ restriction site)
[0023] P2: GG GGATCC TTATTCCTTACTTCTTAAACTTTC (the underline is the BamHI restriction site)
[0024] PCR amplification of human interferon α2b gene, the amplification system is as follows:
[0025]
[0026] The PCR reaction procedure includes:
[0027]
[0028]
[0029] The PCR product was separated by 1% agarose gel electrophoresis, and then the human interferon α2b gene fragment of the PCR product was recovered with an AxyPrep DNA Gel Recovery Kit (AXYGEN Company).
[0030] (1.2) Cut PCR recovery product and pJW2 with the same restr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



