Method for quickly and simply screening CRISPR/Cas gene editing positive object

A simple and convenient technology for gene editing, applied in the biological field, can solve the problems of false positives and false negatives, omission of qualified samples, increased costs, etc., to achieve the effect of reducing experimental steps and high pass rate

Inactive Publication Date: 2018-04-20
ANHUI NORMAL UNIV
View PDF3 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Problems with the above methods: Method A: The scope of application is narrow, only when the distance between the two cutting sites is large enough, the results of agarose gel electrophoresis can be used to judge; qualified samples will be missed, for example, in 1 or 2 Samples in which the DNA sequence of the cleavage site is changed
Method D: A large amount of sequencing costs will be incurred; since sequencing requires a certain amount of time, and if non-target individuals cannot be excluded, it is necessary to maintain the survival of all individuals, which increases labor and material costs
Method E: Multiple operating steps are added, which makes the screening time longer; the price of mismatched enzymes is higher, which increases the cost, and will produce false positives and false negatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly and simply screening CRISPR/Cas gene editing positive object
  • Method for quickly and simply screening CRISPR/Cas gene editing positive object
  • Method for quickly and simply screening CRISPR/Cas gene editing positive object

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] A quick and easy method for screening CRISPR / Cas gene editing positive objects, comprising the following steps:

[0048] Specifically, the mHnrnpa2b1 gene single point knockout screening in CHO-K1 cells

[0049] On NCBI, query the genome information of Hnrnpa2b1 (NCBI Gene ID: NM_016806.3). Design a knockout site KO1 and its corresponding Oligo DNA sequences KO1-F, KO1-R, and design upstream and downstream sequencing primers F and R ( image 3 ).

[0050] KO1-F: caccgAGCGACTGAGTCCGCGATGG

[0051] KO1-R: aaacCCATCGCGGACTCAGTCGCTc

[0052] F: GTGGGGTTAATAGCTCAGCT

[0053] R: AGAAGGAACAGGCTAAGGTG

[0054] 1) After the Oligo DNA corresponding to the knockout site KO1 was hybridized, it was connected to the BbsI site of the pSpCas9-2A-puro knockout vector to construct a plasmid pKO1.

[0055] 2) Transform Top10Competent Cell, screen positive recombinants and verify by sequencing.

[0056] 3) Large-scale extraction of plasmids and endotoxin removal for transfection;

...

Embodiment 2

[0072] A quick and easy method for screening CRISPR / Cas gene editing positive objects, comprising the following steps:

[0073] Specifically: double-site knockout screening of period1 gene in MEF cells

[0074] On NCBI, query the genome information of Period1 (NCBI Gene ID: 18626). Design two knockout sites KO1 and KO2 and their corresponding Oligo DNA sequences KO1-F, KO1-R, KO2-F, KO2-R, and design upstream and downstream sequencing primers CXF and CXR ( Figure 5 ).

[0075] KO1-F: caccgATTAGTCAGCCTCAGAGAC

[0076] KO1-R: aaacGTCTCTGAGGGCTGACTAATc

[0077] KO2-F: caccgCCCCCATCGGCCCCTTCTAG

[0078] KO2-R: aaacCTAGAAGGGGCCGATGGGGGc

[0079] CXF: GTGGGGTTAATAGCTCAGCT

[0080] CXR: AGAAGGAACAGGCTAAGGTG

[0081] 1) The Oligo DNA corresponding to the two knockout sites KO1 and KO2 were hybridized respectively, and connected to the BbsI site of the pSpCas9-2A-puro knockout vector to construct plasmids pKO-1 and pKO-2.

[0082] 2) Transform Top10Competent Cell, screen posit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for quickly and simply screening a CRISPR / Cas gene editing positive object. Compared with the prior art, the method disclosed by the invention has the characteristics that an Oligo DNA segment for constructing a knockout vector is used as a PCR (Polymerase Chain Reaction) primer for screening a target sample, and possible mutations on the DNA can be detected by using the feature that PCR can be efficiently initiated by completely matching a sequence at 3'-terminal of the primer with a template needed in the PCR reaction. By adoption of the method disclosed by the invention, experimental steps are reduced and design of extra PCR primers is not needed; the method is suitable for almost all experimental designs; special DNA endonuclease does not need to be purchased and a false positive result is hardly generated. Moreover, a sample for sequencing has higher qualification rate and qualified samples are hardly missed.

Description

technical field [0001] The invention belongs to the field of biology, and in particular relates to a fast and simple method for screening positive objects of CRISPR / Cas gene editing. Background technique [0002] With the continuous development of science and technology, gene editing technology has also made great progress. At present, the three main technologies are ZFN, TANLEN and CRIPSR technology. CRISPR technology has increasingly become a mainstream technology due to its simplicity and low cost, and has been successfully applied to different species, including but not limited to animals, plants and microorganisms. [0003] CRISPR / Cas system (CRISPR-related system), CRISPR (clustered regulatory interspaced short palindromic repeat) is a clustered, regularly spaced short palindromic repeat sequence, which is a site in the genome that contains multiple short repeat sequences. It acts as an acquired immunity in bacteria and archaea. The CRISPR system mainly relies on crR...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6869
CPCC12Q1/6869C12Q2531/113C12Q2565/125
Inventor张盛周高源隆
OwnerANHUI NORMAL UNIV