Check patentability & draft patents in minutes with Patsnap Eureka AI!

Deoxyribonucleic acid (DNA) bar code standard sequences of sibling species of culicoides latreille, and molecular identification method of sibling species of culicoides latreile

A standard sequence and barcode technology, applied in recombinant DNA technology, DNA/RNA fragments, botanical equipment and methods, etc., to ensure accuracy and reliability, and rapid identification

Inactive Publication Date: 2018-05-15
ZUNYI MEDICAL UNIVERSITY
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no COI gene sequences of Culicoides long-billed, Culicoides Hsinchu and Culicoides albicans in GenBank.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Deoxyribonucleic acid (DNA) bar code standard sequences of sibling species of culicoides latreille, and molecular identification method of sibling species of culicoides latreile
  • Deoxyribonucleic acid (DNA) bar code standard sequences of sibling species of culicoides latreille, and molecular identification method of sibling species of culicoides latreile
  • Deoxyribonucleic acid (DNA) bar code standard sequences of sibling species of culicoides latreille, and molecular identification method of sibling species of culicoides latreile

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Acquisition of COI gene sequences of Culicoides relatives such as Culicoides long-billed, Culicoides Hsinchu and Culicoides albino

[0062] 1. Collection and preservation of specimens of Culicoides relatives such as Culicoides long-beaked, Culicoides Hsinchu and Culicoides albino

[0063] Specimens of Culicoides relatives such as Culicoides long-billed, Culicoides Hsinchu, and Culicoides albino were collected from wild habitats in Yunnan, Sichuan and other provinces by net sweeping and lamp lure methods, and preserved in 95% alcohol. The dissection was performed under a stereoscope with a dissecting needle, and the rest except the chest were made into permanent mounts, which were appraised by authoritative experts to ensure the accuracy of the appraisal results. The thoraxes of Culicoides long-billed, Culicoides Hsinchu and Culicoides leucorrhizae were individually marked for molecular experiments.

[0064] 2. Genomic DNA extraction

[0065] After grinding t...

Embodiment 2

[0083] Example 2 Identification of Unknown Culicoides

[0084] 1. Collection and preservation of midge specimens

[0085] Midge specimens were collected from wild habitats by sweeping nets and lamp lures, and preserved in 95% alcohol. Dissection was performed under a stereoscope with a dissecting needle, and all but the chest were made into permanent mounts for morphological identification. Molecular experiments were carried out after marking the thorax of midges individually.

[0086] 2. Genomic DNA extraction

[0087] After the preserved midge breast was ground, the genome DNA of a single unknown midge was extracted according to the instructions of the QIAGEN DNeasy Blood & Tissue Kit, and stored at -20°C for later use.

[0088] 3. Primer synthesis

[0089] The primers used in this example are as follows:

[0090] Forward primer: 5'TAAACTTCAGGGTGACCAAAAAAATCA 3'.

[0091] Reverse primer: 5'GGTCAACAAATCATAAAGATATTGG 3'.

[0092] 4. PCR amplification

[0093] The PCR r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses deoxyribonucleic acid (DNA) bar code standard sequences of sibling species of culicoides latreille, and a molecular identification method of the sibling species of the culicoides latreille. The molecular identification method is characterized in that a molecular biology DNA sequencing method is adopted to obtain COI gene sequences of the sibling species, such as culicoideslongirostris, culicoides liui and culicoides albifascia tokunaga, of the culicoides latreille, and then comparison of the similarity of the gene sequences is performed, so that the sibling species ofthe culicoides latreille can be identified according to comparison results. The molecular identification method of the sibling species, such as the culicoides longirostris, the culicoides liui and theculicoides albifascia tokunaga, of the culicoides latreille is beneficial to implementation of rapid and accurate identification of the culicoides longirostris, the culicoides liui and the culicoidesalbifascia tokunaga.

Description

technical field [0001] The invention relates to the field of identification of insect species, in particular to a DNA barcode standard sequence of Culicoides close relatives such as Culicoides long-beaked, Culicoides Hsinchu and Culicoides albino, and a molecular identification method thereof. Background technique [0002] Culicoides ( Culicoides Latreille, 1809) belongs to the class Insecta (Insecta) Diptera (diptera) Ceratopogonidae (Ceratopogonidae), its size is small, various, and widely distributed, there are 1368 species in the world, 347 species are known in China, and in the world New species are still being discovered in the range. Blood-sucking midges are midges that can transmit insect-borne pathogens by sucking the blood of ruminants, including Culicoides Culicoides , Midge Lasiohelea , Micromidge Leptoconops and Midges Austroconops Wait. Among blood-sucking midges of the genus Culicoides, pathogens transmitted by midge vectors include bluetongue virus ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6806C12N15/53C12N15/11
CPCC12Q1/6806C12Q1/6888C12Q2600/166C12Q2531/113C12Q2565/125
Inventor 侯晓晖岑常活段琛
Owner ZUNYI MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More