Unlock instant, AI-driven research and patent intelligence for your innovation.

A genetically engineered single-chain antibody strain capable of stably expressing anti-interferon gamma and its application

A single-chain antibody and genetic engineering technology, which can be used in genetic engineering, application, plant genetic improvement, etc., and can solve problems that have not been reported

Active Publication Date: 2021-03-30
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, the research on the immunological detection method of interferon gamma based on genetically engineered antibody has not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A genetically engineered single-chain antibody strain capable of stably expressing anti-interferon gamma and its application
  • A genetically engineered single-chain antibody strain capable of stably expressing anti-interferon gamma and its application
  • A genetically engineered single-chain antibody strain capable of stably expressing anti-interferon gamma and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Preparation and identification of the single-chain antibody of the present invention.

[0030] 1. Expression and purification of interferon-γ antigen

[0031] In this experiment, the DNA sequence of interferon γ antigen will be used as a template, and specific primers (IFN-γ-F:CAAGAATTCTGTTACT GCCAGGACCCATATGT; IFN-γ-R:TTAAAGCTTCTGGGATGCTCTTCGACCTCGA) will be designed for PCR amplification. Digested with enzymes, connected with the prokaryotic expression vector pET28a with the same restriction enzymes, and constructed the recombinant expression vector pET28a- IFN-γ. Transform Escherichia coli competent cells BL21, induce expression with IPTG (concentration: 1mM / L), and pass Ni 2+ High-purity IFN-γ antigen protein was obtained by affinity chromatography. Specific steps are as follows:

[0032] 1), IFN-γ Gene amplification reaction system:

[0033] PCR mixture 25 µL

[0034] IFN-γ -F(20 mM) 0.5 µL

[0035] IFN-γ -R(20 mM) 0.5 µL

[0036] Template DNA 2 µL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
recovery rateaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of antibody engineering, and particularly relates to a stably expressed anti-interferon gamma (IFN-gamma) genetically engineered single-chain antibody strain and application. A gene of an interferon gamma is cloned in vitro through a genetic engineering measure to build a prokaryotic expression vector; isopropyl thiogalactoside (IPTG) induction, expression and purification are performed to obtain soluble interferon antigen protein. The anti-(IFN-gamma) genetically engineered single-chain antibody strain capable of realizing stable secretory expression is selected by using a phage display technology, and a functional single-chain antibody is expressed and purified by building the prokaryotic expression vector; by use of a competitive enzyme-linked immunosorbent assay (ELISA) method, qualitative and quantitative detection for IFN-gamma in human body is realized; a foundation is laid for commercial development and production of a high-quality enzyme-linked immunosorbent assay kit and a gold-labelled antibody detection card.

Description

technical field [0001] The invention belongs to the field of antibody engineering, in particular to a genetically engineered single-chain antibody strain capable of stably expressing anti-interferon gamma and its application. Background technique [0002] Interferon-γ (Interferon-γ, IFN-γ) is a cytokine mainly produced and secreted by activated T cells and natural killer cells (NK cells), and is the only member of type II interferon. The interferon gamma monomer is a core composed of six alpha helices and a fragment sequence extended in the C-terminal region. The biologically active interferon gamma dimer is formed by two antiparallel interlocked monomers and is widely found in the blood of humans and mammals. Interferon gamma has antiviral, immunomodulatory and antitumor properties. Studies have also reported that interferon can be used to treat infectious diseases, but it can also promote autoimmunity. [0003] At present, electrochemical methods are generally used for ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/13C12N15/70G01N33/68C12R1/19
CPCC07K16/249C07K2317/622G01N33/6866
Inventor 王荣智杨航王俊程钟燕芳汪世华凌素美
Owner FUJIAN AGRI & FORESTRY UNIV