Detection method of low requency mutated DNA fragment and library building method

A low-frequency mutation and detection method technology, applied in the field of genetic engineering, can solve the problems of low efficiency of capturing DNA fragments, low sensitivity, low detection limit, etc., and achieve the effect of improving sensitivity, improving sensitivity, and simple steps.

Active Publication Date: 2018-06-22
HUNAN YEARTH BIOTECHNOLOGICAL CO LTD
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the problems existing in the existing technology, the present invention provides a method for detecting DNA fragments with low frequency mutations and a method for building a library. Low fragment efficiency, introduction of wrong mutations during library construction, low detection limit, low sensitivity Technical problems, improve specificity, reduce false positive rate, and increase template utilization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of low requency mutated DNA fragment and library building method
  • Detection method of low requency mutated DNA fragment and library building method
  • Detection method of low requency mutated DNA fragment and library building method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] In this example, the target detection gene is exon 18 of the EGFR gene, and the library construction process is as follows: figure 1 shown, follow the steps below:

[0066] (1) First, perform targeted sequencing on exon 18 of the EGFR gene, according to figure 2 Based on the principle, specific primers are designed for exon 18 of EGFR. The number of templates that can be used by the primers in this example is much higher than that of traditional methods, which increases the number of effective templates for capture and improves the detection sensitivity of low-frequency mutation samples.

[0067] The sequence of exon 18 of EGFR is as follows:

[0068] CTTGTGGAGCCTCTTACACCCAGTGGAGAAGCTCCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTG GG CTCCGGTGCGTTCGGCACGGTGTATAAG

[0069] Wherein the underlined base is the mutation site;

[0070] The sequences of exon 18 of EGFR and its upstream and downstream introns are as follows:

[0071] CAGTTAATAGGCGTGGAAACAGAC...

Embodiment 2

[0122] Embodiment 2 of the present invention is to test the detection limit of the detection method, according to the following steps:

[0123] (1) Low-frequency mutation standard preparation:

[0124] The cfDNA standard (Horizon Discovery, HD780) was used to detect the L858R site of exon 21 of the EGFR gene. The mutation frequencies were 0%, 0.1%, 1%, and 5%, respectively, and were named: S0, S1, S2, and S3.

[0125] (2) Library construction:

[0126] S0, S1, S2, and S3 were respectively captured according to the hybrid capture method in Example 1, and the subsequent steps were carried out according to the steps in Example 1 for library construction.

[0127] (3) qPCR quality inspection and on-machine sequencing:

[0128] The library was subjected to qPCR quality control and on-machine sequencing according to the method in Example 1.

[0129] Experimental results:

[0130] 1) Library electrophoresis detection and analysis results:

[0131] According to the results of ele...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a detection method of a low frequency mutated DNA fragment and a library building method. The technical problems that in the existing detection technique, the DNA fragment capturing efficiency is low, wrong mutation is introduced in the library building process, the detection limit is low, and the sensitivity is low are solved by adopting the hybrid capturing and molecular tagging technique and meanwhile combining with a special library building mode, the library specificity is improved, the false positive rate is lowered, and the template utilization rate is improved.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for detecting low-frequency mutation DNA fragments and a method for establishing a library. Background technique [0002] Gene mutation has the characteristics of universality, randomness, low frequency and non-directionality. The detection of somatic mutations by means of Next Generation Sequencing (Next Generation Sequencing) plays an important role in tumor research and tumor diagnosis. In tumor samples and circulating tumor nucleic acids, mutant cells only account for a small portion, and the DNA is severely fragmented. Efficient and accurate use of these DNAs has great guiding significance for the diagnosis, monitoring, and targeted intervention of early tumors. [0003] The traditional detection fragmentation method is mainly through PCR amplification enrichment of the region to be tested. Since the designed PCR primers are distributed on ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6855C40B50/06
CPCC12Q1/6855C40B50/06C12Q2531/113C12Q2521/501
Inventor 陆利秦闯华徐根明潘艺赵谦
Owner HUNAN YEARTH BIOTECHNOLOGICAL CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap