A new method for simple and convenient detection of SNPs
A tomato and strip technology, applied in biochemical equipment and methods, recombinant DNA technology, and microbial determination/inspection, etc., can solve problems such as sample contamination, DNA quality, high technical level of DNA concentration, false positives, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] Example 1, Effect comparison of different numbers of mismatched bases in primers
[0081] Take a SNP on the first exon of the tomato Solyc03g005870.2.1 gene as an example, and the full name of the SNP is SNP144. SNP144 is an A / C polymorphism. SNP144 and its surrounding nucleotides are shown in sequence 1 of the sequence listing.
[0082] 1. Construction of recombinant plasmids
[0083] The double-stranded DNA molecule shown in Sequence 1 of the Sequence Listing (in this case, M is A) was cloned into a cloning vector to obtain recombinant plasmid A. The double-stranded DNA molecule shown in Sequence 1 of the Sequence Listing (in this case, M is C) is cloned into a cloning vector to obtain recombinant plasmid C.
[0084] 2. Design and preparation of primers
[0085] 1. Design of primers (single base mismatch primers)
[0086] The following four primers were designed: primer SNP144-C1F, primer SNP144-A1F, primer SNP144-A201F and primer SNP144-R.
[0087] Primer SNP14...
Embodiment 2
[0176] Example 2, Genotype Detection of Tomato Spotted Wilt Related SNP Marker SNP724 Site
[0177] Take a tomato spotted wilt related SNP in the tomato genome as an example, the full name of the SNP is SNP724. SNP724 is a G / A polymorphism. SNP724 and its surrounding nucleotides are shown in sequence 9 of the sequence listing. A is the resistant allele and G is the susceptible allele.
[0178] 1. Design and preparation of primers
[0179] The following four primers were designed: primer SNP724-AF, primer SNP724-GF, primer SNP724-G20F and primer SNP724-R.
[0180] Primer SNP724-AF (SEQ ID NO: 10): 5'-TCATGGACACAACTGGAGTTATgA-3';
[0181] Primer SNP724-GF (SEQ ID NO: 11): 5'-TCATGGACACAACTGGAGTTATgG-3';
[0182] Primer SNP724-G20F (SEQ ID NO: 12): 5'- GATAAAGCTTTGGAATGGAA TCATGGACACAACTGGAGTTATgG-3';
[0183] Primer SNP724-R (SEQ ID NO: 13): 5'-CTTTGTCTGGCGAAACTAGGGAACAG-3'.
[0184] Primer SNP724-AF is an upstream primer, the first nucleotide from the 3' end correspond...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



