A new method for simple and convenient detection of SNPs

A tomato and strip technology, applied in biochemical equipment and methods, recombinant DNA technology, and microbial determination/inspection, etc., can solve problems such as sample contamination, DNA quality, high technical level of DNA concentration, false positives, etc.

Active Publication Date: 2021-07-16
山东玄康种业科技有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Whole-genome sequencing and SNP chip hybridization are the most efficient and direct methods for discovering SNPs, but these two methods require large instruments and highly skilled technicians, and are suitable for high-throughput detection of multiple SNP sites
Taqman probe method, competitive allele-specific (KASP) detection and high-resolution melting curve (HRM) can realize the detection of the determined target SNP site through the Real-Time PCR instrument, but these three methods require The use of fluorescent dyes to achieve SNP typing, compared with ordinary PCR, is still more expensive, and these three detection methods have higher requirements for DNA quality, DNA concentration, and the technical level of instrument operators, and slight sample contamination or concentration fluctuations Inhomogeneity can lead to false positives, leading to poor repeatability of some results and affecting the detection conclusion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A new method for simple and convenient detection of SNPs
  • A new method for simple and convenient detection of SNPs
  • A new method for simple and convenient detection of SNPs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] Example 1, Effect comparison of different numbers of mismatched bases in primers

[0081] Take a SNP on the first exon of the tomato Solyc03g005870.2.1 gene as an example, and the full name of the SNP is SNP144. SNP144 is an A / C polymorphism. SNP144 and its surrounding nucleotides are shown in sequence 1 of the sequence listing.

[0082] 1. Construction of recombinant plasmids

[0083] The double-stranded DNA molecule shown in Sequence 1 of the Sequence Listing (in this case, M is A) was cloned into a cloning vector to obtain recombinant plasmid A. The double-stranded DNA molecule shown in Sequence 1 of the Sequence Listing (in this case, M is C) is cloned into a cloning vector to obtain recombinant plasmid C.

[0084] 2. Design and preparation of primers

[0085] 1. Design of primers (single base mismatch primers)

[0086] The following four primers were designed: primer SNP144-C1F, primer SNP144-A1F, primer SNP144-A201F and primer SNP144-R.

[0087] Primer SNP14...

Embodiment 2

[0176] Example 2, Genotype Detection of Tomato Spotted Wilt Related SNP Marker SNP724 Site

[0177] Take a tomato spotted wilt related SNP in the tomato genome as an example, the full name of the SNP is SNP724. SNP724 is a G / A polymorphism. SNP724 and its surrounding nucleotides are shown in sequence 9 of the sequence listing. A is the resistant allele and G is the susceptible allele.

[0178] 1. Design and preparation of primers

[0179] The following four primers were designed: primer SNP724-AF, primer SNP724-GF, primer SNP724-G20F and primer SNP724-R.

[0180] Primer SNP724-AF (SEQ ID NO: 10): 5'-TCATGGACACAACTGGAGTTATgA-3';

[0181] Primer SNP724-GF (SEQ ID NO: 11): 5'-TCATGGACACAACTGGAGTTATgG-3';

[0182] Primer SNP724-G20F (SEQ ID NO: 12): 5'- GATAAAGCTTTGGAATGGAA TCATGGACACAACTGGAGTTATgG-3';

[0183] Primer SNP724-R (SEQ ID NO: 13): 5'-CTTTGTCTGGCGAAACTAGGGAACAG-3'.

[0184] Primer SNP724-AF is an upstream primer, the first nucleotide from the 3' end correspond...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a new method for simple and convenient detection of SNP. The primer set provided by the present invention; primer set I includes two upstream primers and one downstream primer; the difference between the FX1 primer and the FY1 primer: the first nucleotide at the 3' end, the FX1 primer corresponds to the X polymorphism of the specific SNP, FY1 The primers correspond to the Y polymorphism; FX1 primers and FY1 primers are both base mismatch primers; primer set II includes two upstream primers and one downstream primer; the difference between FX2 primers and FY2 primers: the first nucleotide at the 3' end is different, The FX2 primer corresponds to the X polymorphism of the specific SNP, and the FY2 primer corresponds to the Y polymorphism; 10-20 random nucleotides are added to the 5' end of the FY2 primer; both the FX2 primer and the FY2 primer are base mismatch primers. The primer set provided by the invention can be widely used in the detection of various target SNP sites, and has broad application prospects.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a new method for simple and convenient detection of SNP. Background technique [0002] The genetic information of life is stored in the DNA sequence, and the entire DNA of each cell constitutes the genome of the organism. Genomic DNA sequence variation is the basis of species genetic diversity, and single nucleotide variation is the most basic variation form of DNA sequence. With the rapid development of whole genome sequencing technology, a large number of single nucleotide polymorphisms (singlenucleotide polymorphisms, SNP) data have been mined, widely used as genome characteristic markers, and become the third generation of molecular breeding mark. [0003] SNP markers are developed based on single nucleotide polymorphisms, which mainly refer to DNA sequence polymorphisms caused by single nucleotide variations at the genomic level. The number of SNP markers is large...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6858C12Q1/6895C12N15/11
CPCC12Q1/6858C12Q1/6895C12Q2600/13C12Q2600/156
Inventor张松王喜萍张丛省
Owner山东玄康种业科技有限公司