Kit and method using mito-CRISPR/Cas9 system for knocking out DNA of abnormal mitochondria

A mito-cas9 and mito-crispr technology, applied in the field of gene editing, can solve the problems of complex operation and difficult construction of abnormal mitochondrial DNA knockout system, and achieve the effect of treating mitochondrial diseases

Active Publication Date: 2018-08-03
CHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACADEMY OF SCI
View PDF0 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of the shortcomings of the prior art described above, the purpose of the present invention is to provide a kit and method for knocking out abnormal mitochondrial DNA using the mito-CRISPR / Cas9 system, which is used to solve the problem of operating the abnormal mitochondrial DNA knockout system in the prior art Complicated, Difficult to Build, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method using mito-CRISPR/Cas9 system for knocking out DNA of abnormal mitochondria
  • Kit and method using mito-CRISPR/Cas9 system for knocking out DNA of abnormal mitochondria
  • Kit and method using mito-CRISPR/Cas9 system for knocking out DNA of abnormal mitochondria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] 1. Selection of targeting sites

[0039] The present invention selects the ND1 gene in human mitochondria and the Dloop gene in zebrafish mitochondria. According to the editing characteristics of CRISPR / CAS9, the site is generally the 20bp sequence immediately before the NGG characteristic sequence, so the target site sequence is designed on the ZIFITTargeter (http: / / zifit.partners.org / ZiFiT / ChoiceMenu.aspx) website.

[0040] 2. Selection of relevant elements for plasmid construction

[0041] The technology for realizing mitochondrial gene modification in the present invention includes gene cloning technology, CRISPR / CAS9 gene editing technology and homologous recombination technology. In the embodiment of the present invention, the nuclear localization signal in the original vector pSpCas9(BB)-2A-eGFP is replaced by the mitochondrial localization signal by using cloning technology, so as to realize the knockout of the target gene.

[0042] In addition, the exogenous si...

Embodiment 2

[0112] Insertion of exogenous ssDNA sequences into the zebrafish mitochondrial genome by homologous recombination

[0113] Step 1: Construct the gRNA sequence of the targeting sequence

[0114] At first, the genome sequence of the Dloop gene of zebrafish was found on the website of NCBI (National Center for Biotechnology Information, USA). Find the 3'UTR region, and the locked target sequence is GCTTTGTCACATGTATGTAC.

[0115] Then, in order to construct the targeting sequence gRNA, synthesize the following primers;

[0116] Dloop-gRNA-F: TAATACGACTCACTATAGGGCTTTGTCACATGTATGTACGTTTTTAGAGCTAGAAATAGC

[0117] Dloop-gRNA-R:AGCACCGACTCGGTGCCAC

[0118] Using the plasmid with the gRNA backbone as a template, the DNA sequence of the gRNA was amplified using gRNA-F and gRNA-R at a final concentration of 10 μM as primers.

[0119] The formula is as shown in table 3:

[0120] table 3

[0121]

[0122]

[0123] PCR programming:

[0124] Step 1: 95°C for 2 minutes;

[0125] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Outer diameteraaaaaaaaaa
The inside diameter ofaaaaaaaaaa
Login to View More

Abstract

The invention provides a method and a kit using a mito-CRISPR / Cas9 system for editing DNA of abnormal mitochondria. The kit comprises DNA fragments for human or fish mitochondria, targeting mitochondrion gRNA and a mito-CRISPR / Cas9 expression system. The mito-CRISPR / Cas9 system comprises mitochondrial localization signal mNLS and mCas 9 protein or mRNA and correlated expression vector of mCas 9. The mito-CRISPR / Cas9 system is used for targeting deletion of DNA of the abnormal mitochondria in human and fish cells, so that proportion of normal mitochondria is increased, normal mitochondria are dominant, and mitochondrial diseases are treated by correcting mutation sites.

Description

technical field [0001] The invention relates to the technical field of gene editing, in particular to a kit and method for knocking out abnormal mitochondrial DNA by using the mito-CRISPR / Cas9 system. Background technique [0002] Mitochondria originated from a species of Proteobacteria that lived in symbiosis with unicellular eukaryotes 1.5 billion years ago. Mitochondria are organelles with a double-membrane structure, which generate a large amount of ATP through oxidative phosphorylation for energy metabolism, calcium storage, and cell apoptosis. A cell contains a large number of mitochondria, and there are dozens of mitochondrial DNA (mtDNA) in a mitochondria. mtDNA encodes polypeptide chains and essential RNAs (2 ribosomal RNAs and 22 transfer RNAs) in the oxidative phosphorylation (OXPHOS) system, which are critical for protein translation in cells. [0003] Typically, mutated mitochondrial DNA (mtDNA) coexists with normal mtDNA in low proportions in mitochondria. M...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/90
CPCC12N15/8509C12N15/907C12N2800/80C12N2810/10
Inventor裴得胜罗娟娟边万平
OwnerCHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACADEMY OF SCI