Quality detection method for Dendrobium devonianum Paxton
A quality inspection method and technology of Dendrobium denticola, which are applied in measurement devices, instruments, scientific instruments, etc., can solve problems such as the inability to fully reflect the overall curative effect, achieve strong interpretation pertinence and applicability, accurate quality evaluation, and solve dimensionality. effects of disaster
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] The generation sequencing of embodiment 1 dendrobium dendrobium
[0053] First-generation sequencing primer sequences:
[0054] ITS-26SE: 5'GAATTCCCCGGTTCGCTCGCCGTTAC 3';
[0055] ITS-17SE: 5' ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.
[0056] The amplification and sequencing parameters are: denaturation at 98°C for 2 minutes and then PCR cycle, the PCR cycle parameters are 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C after the amplification, and perform Generation Molecular Sequencing.
[0057] Through the first-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium dendrobii.
Embodiment 2
[0058] The extraction method of embodiment 2 dendrobium dendrobium
[0059] Take the dried sample of Dendrobium dendrobii, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (aperture 0.335mm), accurately weigh 1.000g of Dendrobium powder (weighing error cannot exceed 0.2%), place it in a 100ml Erlenmeyer flask, add 50mL 75 % methanol (V water: V methanol = 25:75), take it out after ultrasonication for 30 minutes at room temperature, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve it with 75% methanol solvent (V water: V methanol = 25:75), and finally transfer Dilute it to a 10ml volumetric flask, shake well, and filter with a 0.45 μm microporous membrane to obtain a Dendrobium dendrobium sample solution.
Embodiment 3
[0060] The chromatographic detection method of the Dendrobium dendrobium extract of embodiment 3
[0061] ①Preparation of reference solution
[0062] Accurately weigh 4.10 mg of Schaftoside and 4.08 mg of naringenin, place them in 10 ml volumetric flasks, add 75% (V / V) methanol to dissolve and dilute, shake well, and use them as stock solutions. Refrigerate at 4°C for later use.
[0063] Then accurately draw a certain amount of reference substance stock solution and dilute with 75% methanol to accurately prepare a mixed reference substance solution of schaffertoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared components were diluted. into a high performance liquid chromatograph.
[0064] ②Extraction and treatment of samples for the determination of small molecule components in Dendrobium dendrobii:
[0065] Take 1.00g of the powder of this product (passed through a No. 3 sieve), accurately weigh it, put it in a 100ml volumetric...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap