Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker-assisted rapid reduction of maize leaf angle to improve Jingke 968 plant type

A molecular marker-assisted, corn leaf angle technology, applied in the field of molecular genetics, can solve the problems of low efficiency and long selection time

Active Publication Date: 2021-04-27
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can be seen that using the conventional backcross transfer method, for the traits controlled by a recessive single gene, it is necessary to use backcross and self-cross alternate methods to accurately select the target traits, which takes a long time and low efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker-assisted rapid reduction of maize leaf angle to improve Jingke 968 plant type

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Screening of maize ligule lg1 gene SSR molecular markers

[0031] 1. Using the maize genome database MaizeGDB (http: / / www.maizegdb.org / ), select a total of 9 SSR molecular markers in the upstream and downstream intervals with a close genetic distance to the lg1 gene located at the end of the short arm of the second chromosome of maize.

[0032] Table 1 The positions and primer sequences of the upstream and downstream markers of the ligule gene lg1

[0033] Primer name sequence(5'to3') chromosome location umc2245-L GCCCTGTTATTGGAACAGTTTACG 30.9 umc2245-R CGTCGTCTTCGACATGTACTTCAC isu308337-L TTCTTGCTTGTCTCTAGCAGCTT 35.6 isu308337-R TGTGGCGATGTCCATGATT isu488638-L AGGCAACTCCTGTGTCTGTGT 45.2 isu488638-R CATGATCGCCCACTCCTT umc1165-L TATCTTCAGACCCAAACATCGTCC 47.4 umc1165-R GTCGATTGATTTCCCGATGTTAAA phi098-L GAGATCACCGGCTAGTTAGAGGA 56.72 phi098-R GTATGGTTGGGTACCCGTCTTTCTA ...

Embodiment 2

[0042] Example 2 Breeding of maize liguleless inbred lines

[0043] 1. Acquisition of hybrid offspring F1

[0044] In the summer of the first year, the maize inbred line rla1 (non-recurrent parent, without ligule) was used as the donor, and Jing 92 (available from the Corn Research Center of Beijing Academy of Agriculture and Forestry) (recurrent parent, with ligule, hybrid Jingke 968's male parent) as a recipient hybrid combination F 1 Generation, Harvest F 1 generation of seeds.

[0045] The first generation in Hainan in the winter of the same year, planting F 1 generation seed, get F 1 Substitute maize plants.

[0046] 2. Obtain the BC1 generation by backcrossing once

[0047] (1) Backcross

[0048] The F1 generation plants were used as the female parent, and continued to backcross with the recurrent parent Jing 92, and the seeds of the BC1 generation were harvested. In the winter of the same year, the second generation in Hainan planted the seeds of the BC1 generat...

Embodiment 3

[0074] Example 3 Improving Jingke 968 Plant Type to Obtain Corn Hybrids with Reduced Leaf Angle

[0075] Jingke 968 is a maize variety bred from Beijing 724×Jing 92 by the Maize Research Center of Beijing Academy of Agriculture and Forestry Sciences. In this example, the maize inbred line Jing 724 was used as the female parent, and the ligule-less inbred line Jing 92Y obtained in Example 2 was used as the male parent to obtain Biyuan Jingke 968 (combined from Jing 724 and Jing 92). Obtained) a compact maize hybrid with reduced leaf angle of about 10 degrees and no significant difference in other traits from the original variety Jingke 968.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for improving the plant type of Jingke 968 by quickly reducing the included angle of corn leaves assisted by molecular markers. The present invention utilizes two SSR molecular markers closely linked with maize liguleless gene lg1, maize Jing 92 is used as the recurrent parent, and the maize inbred line with the liguleless trait containing the lg1 gene is used as the non-recurrent parent. Foreground and background selection assisted by secondary backcrossing and molecular markers, the genetic background obtained by selfing is basically the same as that of the recurrent parent, and the maize inbred line that exhibits the trait of liguleless can quickly be obtained by combining the parental liguleless inbred line with Jing724. A compact maize hybrid whose genetic background is basically the same as that of the original hybrid and whose leaf angle is obviously reduced is obtained. The method of the invention can save nearly half of the breeding time, and can quickly reduce the leaf angle of existing hybrids, greatly promoting the breeding work of compact corn hybrids with small leaf angles, and has good application prospect.

Description

technical field [0001] The invention relates to the field of molecular genetics, in particular to a method for improving the plant type of Jingke 968 by using the SSR molecular marker linked to the maize ligule gene lg1 to assist in rapidly reducing the angle between maize leaves. Background technique [0002] In recent years, with the breeding goals of maize tolerance to dense planting and high light efficiency, compact plant type and leaf upshoot have become important phenotypic traits that maize breeders pay attention to. Corn leaf angle is an important plant type index, which directly affects the distribution of light in the canopy and the light energy utilization of the population, thereby affecting the process of plant growth and physiological characteristics, and is an important agronomic trait that affects yield. Upright leaves can significantly improve photosynthetic efficiency and plant density, thereby increasing yield. The leaf angle is small and the plant type i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895A01H1/02A01H1/04
CPCA01H1/02A01H1/04C12Q1/6895C12Q2600/156
Inventor 赵久然宋伟苏爱国邢锦丰张如养王元东王继东王帅帅
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES