Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Melon U6 gene and application thereof

A melon, gene technology, applied in genetic engineering, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems such as no primer development and application

Inactive Publication Date: 2018-08-21
VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the U6 gene sequence in melon has not been reported yet, and there is no development and application of related primers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Melon U6 gene and application thereof
  • Melon U6 gene and application thereof
  • Melon U6 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, the cloning of muskmelon U6 gene

[0027] 1. Identification of U6 precursor gene in melon

[0028] In order to identify the U6 gene present in melon, we first downloaded the nucleotide sequence of the Arabidopsis U6 precursor gene from the NCBI database, and used the sequence and the melon genome sequence for Blast analysis. As a result, three U6 precursors were identified from the melon genome The gene sequences are named U6a, U6b, and U6c, respectively. The sequence alignment results of the precursors of melon U6a, U6b, and U6c are as follows: figure 1 shown. At the same time, primers were designed based on the 3 precursor gene sequences for PCR amplification and gel electrophoresis analysis, and the PCR electrophoresis verification results were as follows: figure 2 shown.

[0029] 2. Obtaining the U6snRNA core sequence of melon

[0030] According to the sequence comparison of U6a, U6b and U6c precursor genes, the core sequence of U6 snRNA in melon...

Embodiment 2

[0032] Example 2, qRT-PCR detection of melon U6 gene

[0033] 1. Design primers based on the core sequence of muskmelon U6snRNA. The primer sequences are as follows:

[0034] FP: GACATCCGATAAAATTGGAAC (SEQ ID NO. 2)

[0035] RP: TTTGTGCGTGTCATCCTTGCGC (SEQ ID NO. 3)

[0036] 2. Reverse transcription and PCR amplification of melon U6snRNA

[0037] (1) The reverse transcription primer adopts the above reverse primer (SEQ ID NO.3) designed based on the melon U6 snRNA sequence, and the reverse transcription system and procedure are:

[0038]

[0039] Place at 65°C for 5 minutes, place on ice for 2 minutes, and then add the following premix.

[0040]

[0041] 16°C for 30 minutes, 42°C for 30 minutes, and 85°C for 5 minutes.

[0042] (2) Dilute the reverse transcription product 100 times for PCR detection, the Quantitative RT-PCR reaction system is:

[0043]

[0044]

[0045] The Forward Primer is a forward primer (SEQ ID NO.2) designed based on the sequence of musk...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides melon U6 gene and application thereof. A U6 gene full-length sequence is cloned from a melon for the first time; the gene is highly homologous with U6 gene in arabidopsis, paddyrice and tomatoes; the gene can be preliminarily determined as reference gene for miRNA relative quantitative analysis through constitutive expression in different tissues, such as the root, stem, leaf, flower, fruit and seed, of the melon. Experiments prove that the melon U6 gene and primer thereof has the characteristics of high accuracy and stability when being applied to the melon miRNA relative quantitative analysis, and provides a novel choice for melon gene quantitative expression and analysis.

Description

technical field [0001] The invention belongs to the technical field of plant molecular biology, and relates to the melon U6 gene and its application. Background technique [0002] Melon (Cucumis melo L.) is a Cucurbitaceae crop widely cultivated in the world and has important economic value. In the quantitative analysis of melon gene expression, in order to overcome the influence of abiotic variation and ensure the accuracy of the results, it is most critical to select genes with stable expression as internal references for data standardization. Therefore, the development of internal reference genes that can be stably expressed in different tissues in melon is still a problem in this field. [0003] MicroRNA (miRNA) is a very important class of non-protein-coding small RNA discovered in recent years. Its length is generally 21-24 nucleotides. It mainly regulates genes at the post-transcriptional level by cutting target mRNA or inhibiting its translation process. Express. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12Q1/6895C12Q1/6851
CPCC12N15/113C12N2310/111C12Q1/6851C12Q1/6895C12Q2600/158C12Q2600/166C12Q2600/178C12Q2531/113C12Q2545/101C12Q2525/207
Inventor 高超焦自高王崇启董玉梅孙建磊肖守华
Owner VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com