Unlock instant, AI-driven research and patent intelligence for your innovation.
Melon U6 gene and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A melon, gene technology, applied in genetic engineering, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems such as no primer development and application
Inactive Publication Date: 2018-08-21
VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI
View PDF3 Cites 5 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0006] However, the U6 gene sequence in melon has not been reported yet, and there is no development and application of related primers
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0026] Embodiment 1, the cloning of muskmelon U6 gene
[0027] 1. Identification of U6 precursor gene in melon
[0028] In order to identify the U6 gene present in melon, we first downloaded the nucleotide sequence of the Arabidopsis U6 precursor gene from the NCBI database, and used the sequence and the melon genome sequence for Blast analysis. As a result, three U6 precursors were identified from the melon genome The gene sequences are named U6a, U6b, and U6c, respectively. The sequence alignment results of the precursors of melon U6a, U6b, and U6c are as follows: figure 1 shown. At the same time, primers were designed based on the 3 precursor gene sequences for PCR amplification and gel electrophoresis analysis, and the PCR electrophoresisverification results were as follows: figure 2 shown.
[0029] 2. Obtaining the U6snRNA core sequence of melon
[0030] According to the sequence comparison of U6a, U6b and U6c precursor genes, the core sequence of U6 snRNA in melon...
Embodiment 2
[0032] Example 2, qRT-PCR detection of melon U6 gene
[0033] 1. Design primers based on the core sequence of muskmelon U6snRNA. The primer sequences are as follows:
[0034] FP: GACATCCGATAAAATTGGAAC (SEQ ID NO. 2)
[0035] RP: TTTGTGCGTGTCATCCTTGCGC (SEQ ID NO. 3)
[0036] 2. Reverse transcription and PCR amplification of melon U6snRNA
[0037] (1) The reverse transcription primer adopts the above reverse primer (SEQ ID NO.3) designed based on the melon U6 snRNA sequence, and the reverse transcription system and procedure are:
[0038]
[0039] Place at 65°C for 5 minutes, place on ice for 2 minutes, and then add the following premix.
[0040]
[0041] 16°C for 30 minutes, 42°C for 30 minutes, and 85°C for 5 minutes.
[0042] (2) Dilute the reverse transcription product 100 times for PCR detection, the Quantitative RT-PCR reaction system is:
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides melon U6 gene and application thereof. A U6 gene full-length sequence is cloned from a melon for the first time; the gene is highly homologous with U6 gene in arabidopsis, paddyrice and tomatoes; the gene can be preliminarily determined as reference gene for miRNA relative quantitative analysis through constitutive expression in different tissues, such as the root, stem, leaf, flower, fruit and seed, of the melon. Experiments prove that the melon U6 gene and primer thereof has the characteristics of high accuracy and stability when being applied to the melon miRNA relative quantitative analysis, and provides a novel choice for melon gene quantitative expression and analysis.
Description
technical field [0001] The invention belongs to the technical field of plantmolecular biology, and relates to the melon U6 gene and its application. Background technique [0002] Melon (Cucumis melo L.) is a Cucurbitaceaecrop widely cultivated in the world and has important economic value. In the quantitative analysis of melon gene expression, in order to overcome the influence of abiotic variation and ensure the accuracy of the results, it is most critical to select genes with stable expression as internal references for data standardization. Therefore, the development of internal reference genes that can be stably expressed in different tissues in melon is still a problem in this field. [0003] MicroRNA (miRNA) is a very important class of non-protein-coding small RNA discovered in recent years. Its length is generally 21-24 nucleotides. It mainly regulates genes at the post-transcriptional level by cuttingtarget mRNA or inhibiting its translation process. Express. ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More 
