Melon U6 gene and application thereof
A melon, gene technology, applied in genetic engineering, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems such as no primer development and application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1, the cloning of muskmelon U6 gene
[0027] 1. Identification of U6 precursor gene in melon
[0028] In order to identify the U6 gene present in melon, we first downloaded the nucleotide sequence of the Arabidopsis U6 precursor gene from the NCBI database, and used the sequence and the melon genome sequence for Blast analysis. As a result, three U6 precursors were identified from the melon genome The gene sequences are named U6a, U6b, and U6c, respectively. The sequence alignment results of the precursors of melon U6a, U6b, and U6c are as follows: figure 1 shown. At the same time, primers were designed based on the 3 precursor gene sequences for PCR amplification and gel electrophoresis analysis, and the PCR electrophoresis verification results were as follows: figure 2 shown.
[0029] 2. Obtaining the U6snRNA core sequence of melon
[0030] According to the sequence comparison of U6a, U6b and U6c precursor genes, the core sequence of U6 snRNA in melon...
Embodiment 2
[0032] Example 2, qRT-PCR detection of melon U6 gene
[0033] 1. Design primers based on the core sequence of muskmelon U6snRNA. The primer sequences are as follows:
[0034] FP: GACATCCGATAAAATTGGAAC (SEQ ID NO. 2)
[0035] RP: TTTGTGCGTGTCATCCTTGCGC (SEQ ID NO. 3)
[0036] 2. Reverse transcription and PCR amplification of melon U6snRNA
[0037] (1) The reverse transcription primer adopts the above reverse primer (SEQ ID NO.3) designed based on the melon U6 snRNA sequence, and the reverse transcription system and procedure are:
[0038]
[0039] Place at 65°C for 5 minutes, place on ice for 2 minutes, and then add the following premix.
[0040]
[0041] 16°C for 30 minutes, 42°C for 30 minutes, and 85°C for 5 minutes.
[0042] (2) Dilute the reverse transcription product 100 times for PCR detection, the Quantitative RT-PCR reaction system is:
[0043]
[0044]
[0045] The Forward Primer is a forward primer (SEQ ID NO.2) designed based on the sequence of musk...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com