Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for interspecific identification of Sepiella maindroni, Sepia pharaonis and Sepia lycidas and application

A technique for Mansfield squid and pseudo-squid, which is applied to the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. To solve problems such as proliferation and release, the method is simple and easy to implement, the identification results are accurate and reliable, and the application range is wide.

Inactive Publication Date: 2018-10-16
NINGBO UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Overall, the three species of squid have many similarities in morphology and growth traits, and due to the strong plasticity of the squid phenotype, it is difficult to identify species-level morphological classification, and it is easy to have many differences, and it is difficult to distinguish only by morphology. , and the difference among cuttlefish larvae is even smaller, which is not conducive to the proliferation and release in specific waters

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for interspecific identification of Sepiella maindroni, Sepia pharaonis and Sepia lycidas and application
  • Molecular marker for interspecific identification of Sepiella maindroni, Sepia pharaonis and Sepia lycidas and application
  • Molecular marker for interspecific identification of Sepiella maindroni, Sepia pharaonis and Sepia lycidas and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Identification of Sepia mansoni, Tabby Squid and Squid order in Squididae:

[0038] a. Acquisition of the basis sequence for species identification: Obtain the full length of the above-mentioned squid mitochondrial sequence from the NCBI database, use AlignX software to perform sequence alignment, and find the base difference fragments that exist in the three squid species as the basis sequence for species identification;

[0039] b. Primer design: Select a sequence region that can clearly distinguish the target species from the above-mentioned full-length mitochondrial sequence of Sepia, and use Primer Premier5 software to design PCR amplification primers in this region. The primer amplification products should have obvious Tm among different species The difference in value is mainly reflected in the different content of C and T.

[0040] The forward primer F1 is: 5'CTGTTATCCCTATGGTAACTTTATT 3';

[0041] The reverse primer F2 is: 5'TTAATTGGGGTGATTAAGGAATA 3'.

[0042...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
T maaaaaaaaaa
T maaaaaaaaaa
Login to View More

Abstract

The invention relates to molecular marker for interspecific identification of Sepiella maindroni, Sepia pharaonis and Sepia lycidas and application, belongs to the identification technology of siblingspecies, and particularly discloses a method for the identification of the sibling species of sepia. Specifically, genomic DNA of the Sepiella maindroni, the Sepia pharaonis and the Sepia lycidas areused as a template, primers are designed according to labeling sequence of the genomes of the Sepiella maindroni, the Sepia pharaonis and the Sepia lycidas for PCR amplification, and the differencesof Tm values of amplified products in a high resolution melting (HRM) are used for distinguishing sepia species. The molecular marker for the interspecific identification of the Sepiella maindroni, the Sepia pharaonis and the Sepia lycidas and the application can be used for rapid, economical, simple and convenient identification between species, and the accuracy is 100% compared with the sequencing results of the labeling sequence.

Description

technical field [0001] The invention belongs to the technical field of squid species identification, and in particular relates to a molecular marker and its application which can be used for the interspecies identification of squid mansoni, tiger squid and squid. Background technique [0002] Sepiella maindroni belongs to Cephalopoda, Sepia, Sepiaceae, and Sepia genus. It is widely distributed in the Far East Sea of ​​Russia, the Seto Inland Sea of ​​Japan, the southwestern coast of Korea and the adjacent waters of my country. It is a wide-temperature and wide-spread head. The species of pods are distributed in the four major seas of my country; the tiger squid (Sepia pharaonis) belongs to the phylum Mollusca, order Sepioidea, family Sepiidae, and genus Sepia. Distributed in the tropical waters of the Indo-Pacific, it is found in waters from the shore to a water depth of 100m. Sepia lycidas belongs to Cephalopoda, Sepioidea, Sepiidae, and Sepia. It is a benthic species with ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2600/156C12Q2527/107
Inventor 赵云宋微微王春琳李荣华母昌考
Owner NINGBO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com