Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for obtaining label-free transgenic plant

A transgenic plant, marker-free technology, applied in botany equipment and methods, biochemical equipment and methods, plant products, etc., can solve the problem of cumbersome operation of marker-free transgenic plants, and achieve the effect of simple operation

Active Publication Date: 2018-11-06
CHINA NAT RICE RES INST
View PDF13 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims to provide a method for obtaining marker-free transgenic plants to solve the technical problem of obtaining marker-free transgenic plants in the prior art which is cumbersome to operate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining label-free transgenic plant
  • Method for obtaining label-free transgenic plant
  • Method for obtaining label-free transgenic plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0029] According to a typical embodiment of the present invention, the gene editing protein gene is Cas9 gene or Cpf1 gene, and of course it can also be other protein genes capable of achieving similar gene editing.

[0030] Preferably, the vector also contains elements of the matching Cas9 gene or Cpf1 gene, which is convenient for subsequent operations. In a typical embodiment of the present invention, such as figure 2 As shown, the basic elements of the vector include hygromycin resistance element, gRNA element, MADS15-driven Cas9 system and GFP reporter gene.

[0031] According to a typical embodiment of the present invention, the vector is a binary expression vector, preferably Pcambia 1300.

[0032] According to a typical embodiment of the present invention, the plants used to obtain the marker-free transgenic plants include rice, wheat, potato, sweet potato, poplar and citrus.

[0033] The beneficial effects of the present invention will be further described below in...

Embodiment 1

[0035] 1. Vector Construction

[0036]Using pC1300-Cas9 as the vector, BamHI / NcoI was used for double enzyme digestion, and the vector was linearized. Using rice DNA as a template, primers

[0037] M15-P-F (SEQ ID NO: 2):

[0038] 5'-CGAGCTCGGTACCAAGGATCCGAAAAGCTTACGGGCCTCTTTGA-3'

[0039] M15-P-R (SEQ ID NO: 3):

[0040] 5'-TCTTCTTCTTAGGGGCCATGGTCTCTATCCGCTTCAGCTGCACC-3'

[0041] The 3614bp sequence of the promoter region of LOC_Os07g01820 gene was amplified, and pC1300-MADS15P-Cas9 was constructed by Gibson connection.

[0042] PmeI digestion pC1300-MADS15P-Cas9 vector, primers

[0043] cas-Hgfp-F (SEQ ID NO: 4):

[0044] CGTTTCCCGCCTTCAGTTTAAACTGCCACCTGACGTGAGCTCGGTA

[0045] cas-Hgfp-R (SEQ ID NO: 5):

[0046] TGTCAAACACTGATAGTTTAAACCGGTGTGAGGGAACTAGTTTTGAT

[0047] The 2X35S-driven GFP element sequence was amplified and T4 ligated to construct the pC1300-MADS15P-Cas9-GFP vector. According to the requirements of the CRISPR-Cas9 system for the target sequence (PAM...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for obtaining label-free transgenic plant. The method is implemented by a CRISPR / Cas9 or CRISPR / Cpf1 system, and a vector of the CRISPR / Cas9 or CRISPR / Cpf1 system comprises a gene edited protein gene, a sgRNA of targeting the vector and a specific temporal and spatial expression gene promoter. The specific temporal and spatial expression gene promoter is not expressed during callus period, and the gene edited protein gene is expressed after genetic transformation is completed. The method provided by the invention has simple operation, and mainly aims at cropsor economic plants, especially plants that are perennial and vegetative propagated; large fragments of transgenic components are lost by splicing the vector, and the significance is great.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for obtaining marker-free transgenic plants. Background technique [0002] At present, transgenic technology is widely used in the study of gene function. With the continuous emergence of new varieties of commercialized transgenic plants, people's debates and concerns about the safety of transgenic plants are increasing day by day. CRISPR / Cas9 technology is an emerging gene editing tool that can generate DSBs at specific sites. During the DNA repair process of organisms, insertions, deletions, and substitutions may occur, thereby obtaining mutants at specific points. With gene editing With the continuous optimization of technology, CRISPR / Cas9 technology has been quite perfect for gene knockout, but the growth and development of the plant itself has not been improved after the targeted knockout of the Cas9 system. On the contrary, the existence of Cas9 increases the probabil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N9/22A01H5/00A01H6/46A01H6/82A01H6/00
CPCC12N9/22C12N15/8213
Inventor 王克剑王俊杰
Owner CHINA NAT RICE RES INST