Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Medicine for treating HPV (human papillomavirus) infection and application thereof

A drug and editing technology, applied in the field of biomedicine, can solve the problems of no HPV infection, undisclosed HPV infection, etc., and achieve the effect of reducing the expression level

Active Publication Date: 2018-12-21
THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV +1
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, most of the Crispr / Cas9 system is used to modify the gene to treat viral infection; however, the prior art does not disclose the use of the Crispr / Cas9 system to treat HPV infection, and no one uses the Crispr / Cas13a system to modify the gene to treat HPV infection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medicine for treating HPV (human papillomavirus) infection and application thereof
  • Medicine for treating HPV (human papillomavirus) infection and application thereof
  • Medicine for treating HPV (human papillomavirus) infection and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0018] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below with reference to specific embodiments and accompanying drawings.

[0019] Construction of crRNA and Cas13a expression vector

[0020] The E6 mRNA sequence information of HPV16 was obtained from the NCBI website, and 3 crRNAs were designed, namely: 16E6CR1, 16E6CR2 and 16E6CR3 for HPV16E6 protein; the bold part in the sequence is the coding gene sequence of the DR (directrepeat) sequence of crRNA, the underlined part is the coding gene sequence of the spacer sequence of crRNA, and the sequence is as follows:

[0021] 16E6CR1: atgatctgcaacaagacatacatcgacc , as shown in SEQ ID NO: 1;

[0022] 16E6CR2: aaaagcaaagtcatatacctcacgtcgc , as shown in SEQ ID NO: 3;

[0023] 16E6CR3: ttaatacacctaattaacaaatcacaca , as shown in SEQ ID NO: 2;

[0024] The crRNA and LshCas13a sequence (Cas13 protein is C2c2 prote...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a medicine for treating HPV (human papillomavirus) infection and application thereof. A sequence of crRNA (crispr-derived ribonucleic acid) for targeting mRNA (messenger ribonucleic acid) for editing human papillomavirus E6 protein is shown in SEQ ID NO: 1 or SEQ ID NO:2. The designed crRNA can be used for constructing a Crispr / Cas13a system and can be used for treating theHPV infection.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a medicine for treating HPV infection and its application. Background technique [0002] HPV (Human Papillomavirus) is a spherical DNA virus that causes the proliferation of squamous epithelium of human skin and mucous membranes. The early HPV gene E6 is an oncogene that encodes a viral protein and plays a crucial role in the process of cell transformation and maintenance of the malignant phenotype of transformed tissues. According to the location of HPV infection, it can be clinically divided into: skin low-risk type, skin high-risk type, mucosal low-risk type and mucosal high-risk type. Among them, the mucosal high-risk type includes HPV-16 subtype and HPV18 subtype. [0003] Crispr / Cas technology is a technology that can perform site-specific genetic modification on the DNA sequence of a gene of interest in living cells or tissues. It has become an emerging ta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/90C12N9/22A61K48/00A61K31/7105A61P31/20
CPCA61K31/7105A61P31/20C12N9/22C12N15/113C12N15/90C12N2310/10
Inventor 胡争田瑞樊惟文陈怡李金庄
Owner THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com