Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker primers and applications for identification of kiwifruit Mantianhong 2

A variety identification and molecular marker technology, applied in the field of molecular biology and genetic breeding, can solve the problems of restricting the healthy and sustainable development of the industry, wrong economic benefits of fruit farmers, and impure seedling varieties, and achieves simple and intuitive morphological marking, wide application range, Easy to use effect

Active Publication Date: 2021-05-04
WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the identification of kiwifruit patented varieties is only based on traditional methods such as tree vigor, leaf shape, flowering period, flower shape, and fruit appearance, which are inevitably affected by environmental and other human factors.
Uncertainty about kiwifruit varieties restricts the healthy and sustainable development of the industry, and impure or even wrong seedling varieties will seriously damage the economic benefits of fruit farmers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker primers and applications for identification of kiwifruit Mantianhong 2
  • Molecular marker primers and applications for identification of kiwifruit Mantianhong 2
  • Molecular marker primers and applications for identification of kiwifruit Mantianhong 2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Acquisition of molecular marker primers for identification of kiwifruit 'Mantianhong 2' variety:

[0020] The applicant downloaded the complete gene sequence of 'Hongyang' kiwifruit from the Kiwifruit Genome Sequence website (http: / / bioinfo.bti.cornell.edu / kiwi). SSR markers were developed on a genome-wide scale by SSR Finder software, and SSR marker primers were designed by selecting gene loci according to the results of gene structure annotation. Using the designed and synthesized primers, the kiwifruit variety 'Mantianhong 2' was amplified by PCR, and the molecular marker Geo9-231 was obtained by screening. The primers designed for it were Geo9-231-F: CCATTTATTTTGTCCAGGCG and Geo9-231-R: GGGTGGTAATACTATCGCCATT .

Embodiment 2

[0022] Application of molecular marker primers for variety identification of kiwifruit 'Mantianhong 2':

[0023] (1) The DNA samples of more than 40 different varieties of kiwifruit were extracted according to the CTAB method (the names of the specific varieties are shown in Table 1).

[0024] (2) Pipette the mixture of 990ul HIDI and 10ul ROX500 or LIZ500 into a 96-well reaction plate, 10ul per well.

[0025] (3) Place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop immediately.

[0026] (4) Add the DNA of each sample into the corresponding wells of the 96-well plate, 50 pg of each sample.

[0027] (5) Add the corresponding reagents to the 96-well plate according to the following PCR reaction system, seal the 96-well plate with a sealing film, shake, place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop. The PCR reaction was performed according to the following procedure.

[0028] a. PCR reaction system

[0029] Preparation of 25μl ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and more specifically relates to molecular marker primers and applications for kiwifruit 'Mantianhong No. 2' variety identification. The primers are: Geo9‑231‑F: CCATTTATTTTGTCCAGGCG and Geo9‑ 231‑R: GGGTGGTAATACTATCGCCATT. Using the primers provided by the present invention to amplify the DNA of Mantianhong No. 2, only Mantianhong No. 2 can specifically amplify a 313bp band; according to the size and number of different bands, it can also be used for: 'Bruno ', 'Cuiyu', 'GT815', 'Guichang', 'Fengyue', 'YH‑H8', 'Huayou', 'Jinkui', 'Jintao', 'Jinxia' and other kiwifruit.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and more specifically relates to molecular marker primers and applications for identification of kiwifruit Mantianhong No. 2 variety. Background technique [0002] China is the origin of Actinidia plants and the original origin center of Actinidia genetic resources. In recent years, my country's kiwifruit industry has steadily expanded. As of 2017, the national cultivation area reached 2.4 million mu, with an output of 2.9 million tons, ranking first in the world. In terms of variety pattern, based on the research of local kiwifruit genetic resources, my country has selected and bred new kiwifruit varieties such as 'Jinyan' and 'Donghong', which have been widely cultivated around the world, completely changing the world's kiwifruit industry. Only 'Hayward' The single pattern of varieties has promoted the diversification of the kiwifruit market and consumption. [0...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor 张琼钟彩虹郑浩田华
Owner WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI