Molecular marker primers and applications for identification of kiwifruit Mantianhong 2
A variety identification and molecular marker technology, applied in the field of molecular biology and genetic breeding, can solve the problems of restricting the healthy and sustainable development of the industry, wrong economic benefits of fruit farmers, and impure seedling varieties, and achieves simple and intuitive morphological marking, wide application range, Easy to use effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Acquisition of molecular marker primers for identification of kiwifruit 'Mantianhong 2' variety:
[0020] The applicant downloaded the complete gene sequence of 'Hongyang' kiwifruit from the Kiwifruit Genome Sequence website (http: / / bioinfo.bti.cornell.edu / kiwi). SSR markers were developed on a genome-wide scale by SSR Finder software, and SSR marker primers were designed by selecting gene loci according to the results of gene structure annotation. Using the designed and synthesized primers, the kiwifruit variety 'Mantianhong 2' was amplified by PCR, and the molecular marker Geo9-231 was obtained by screening. The primers designed for it were Geo9-231-F: CCATTTATTTTGTCCAGGCG and Geo9-231-R: GGGTGGTAATACTATCGCCATT .
Embodiment 2
[0022] Application of molecular marker primers for variety identification of kiwifruit 'Mantianhong 2':
[0023] (1) The DNA samples of more than 40 different varieties of kiwifruit were extracted according to the CTAB method (the names of the specific varieties are shown in Table 1).
[0024] (2) Pipette the mixture of 990ul HIDI and 10ul ROX500 or LIZ500 into a 96-well reaction plate, 10ul per well.
[0025] (3) Place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop immediately.
[0026] (4) Add the DNA of each sample into the corresponding wells of the 96-well plate, 50 pg of each sample.
[0027] (5) Add the corresponding reagents to the 96-well plate according to the following PCR reaction system, seal the 96-well plate with a sealing film, shake, place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop. The PCR reaction was performed according to the following procedure.
[0028] a. PCR reaction system
[0029] Preparation of 25μl ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


