Unlock instant, AI-driven research and patent intelligence for your innovation.

Promoters, their vectors and their applications

A promoter and carrier technology, applied in the field of bioengineering, can solve the problems of few species, limited promoter expression activity, and low protein expression efficiency.

Active Publication Date: 2020-02-14
JIANGNAN UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are problems such as low protein expression efficiency and few available genetic tools in the existing technology, and the development of high-efficiency promoters that can be used for foreign protein expression is an important way to solve these problems
Inducible promoters commonly used in recent years include tac promoter (Ptac), arabinose promoter, maltose-inducible promoter, propionate-inducible promoter, temperature-sensitive promoter, etc., but the expression activity of these promoters is very limited and can be Less variety to choose from

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoters, their vectors and their applications
  • Promoters, their vectors and their applications
  • Promoters, their vectors and their applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0063] As one of the embodiments of the present invention: select the gene SEQ ID NO: 6 gene coding sequence ATG of C. glutamicumBZH 001 to design the promoter cloning primer 355ZDA-F and ZDA-R (SEQ ID NO: 6 gene The coding sequence ATG starts from the 501bp base of the SEQ ID NO: 6 sequence, the coding sequence of the SEQ ID NO: 6 gene is the 501bp ~ 1355bp of the sequence table SEQ ID NO: 6), and the promoter sequence and its downstream genes are cloned 62bp sequence (including ATG) after ATG, and 15bp RBS sequence (AAAGGAGGACAACTA) and two reverse Bsa I restriction sites and a BamHI restriction site were sequentially introduced at the 5' end of the downstream primer ZDA-R, and The BamHI restriction site coincides with the cut of the second BsaI restriction site;

[0064] ZDA-F TTCG AAGCTT CTTTGAAGCGGTGTGTGAC (the underline is the enzyme cutting site HindIII)

[0065] ZDA-R

[0066] CCGG GGATCCGAGACC AAAAAAATTTTTT GGTCTC ACATTAGTTGTCTCCTTTTCAGTTGCCTTGTTGCC (the under...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

Disclosed is a promoter, a vector and an application thereof. The promoter includes a promoter core region sequence that includes at least an upstream 91-180 bp interval sequence of Corynebacterium glutamicum SEQ ID NO: 6 gene coding sequence ATG. The promoter and a gene fragment are constructed to form an expression cassette, which can express a large amount of protein in prokaryotes; in particular, after being induced by an inducer, the protein expression activity is significantly higher than that of conventional Ptac.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a promoter, its carrier and its application. Background technique [0002] Promoter is a key DNA sequence that controls the initiation of gene transcription and plays an important role in regulating gene expression. The promoter mainly controls the transcription level of the gene. A large number of studies have proved that in the various sequence regions that control gene expression, the influence of the promoter region is more than 45%. Therefore, the screening of highly active promoters for the study of gene expression is of great significance. [0003] At present, there are problems such as low protein expression efficiency and few available genetic tools in the existing technology, and the development of high-efficiency promoters that can be used for exogenous protein expression is an important way to solve these problems. Inducible promoters commonly used...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/77
CPCC07K14/34C12N15/113C12N15/77C12N2830/34
Inventor 刘秀霞董贵彬赵子豪司雅楠杨艳坤白仲虎
Owner JIANGNAN UNIV