Unlock instant, AI-driven research and patent intelligence for your innovation.

SlbHLH59 gene capable of regulating ascorbic acid content in tomato fruit and application method of SlbHLH59 gene

A technology of ascorbic acid and its application method, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as difficulty, and achieve the effect of enhancing resistance and positioning quickly and effectively

Inactive Publication Date: 2019-01-08
HUAZHONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] The difficulty lies in: AsA, as a primary metabolic trait, is a complex trait regulated by multiple genes with minor effects, and it is also difficult to use traditional parental groups for QTL mapping

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SlbHLH59 gene capable of regulating ascorbic acid content in tomato fruit and application method of SlbHLH59 gene
  • SlbHLH59 gene capable of regulating ascorbic acid content in tomato fruit and application method of SlbHLH59 gene
  • SlbHLH59 gene capable of regulating ascorbic acid content in tomato fruit and application method of SlbHLH59 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0125] Determination of Ascorbic Acid in Tomato Fruit

[0126] The determination of ascorbic acid includes the determination of reduced ascorbic acid and total ascorbic acid, wherein the total ascorbic acid includes reduced ascorbic acid and oxidized ascorbic acid. Specific steps are as follows:

[0127]Step 1: Sample preparation: select a fresh sample to be tested, freeze it with liquid nitrogen, grind it into a powder, weigh about 0.2g of leaf powder or about 0.4g of fruit powder in a 2mL centrifuge tube pre-cooled with liquid nitrogen, and add 1mL 6% TCA solution pre-cooled on ice, fully mixed, extracted on ice in the dark for 15 minutes, centrifuged at 12000r / min at 4°C for 15 minutes; sample processing and ascorbic acid determination;

[0128] Step 2: Determination of total ascorbic acid: Take 20 μL of sample supernatant to a clean microplate, add 20 μL of DTT solution with a concentration of 5 mmol / L, centrifuge and mix in a plate centrifuge, and incubate at 37°C for 20...

Embodiment 2

[0135] Analysis of gene expression in tomato material fruit

[0136] The fruit RNA of related materials was extracted, and the RNA was reverse transcribed into cDNA with a reverse transcription kit. Using LightCycler480SYBR Green I Master Kit, fluorescent quantitative PCR (qRT-PCR) was performed according to the kit steps to detect the relative expression of ascorbic acid anabolic genes. The qRT-PCR primers used in the experiment are shown in Table 1:

[0137] Table 2 qRT-PCR primers used in experiments

[0138]

[0139]

Embodiment 3

[0141] Sequence Analysis of SlbHLH59 Gene

[0142] According to the sequence analysis of candidate gene SlbHLH59 (Solyc09g065820) in NCBI, PCR primers including SlbHLH59 promoter and coding region were designed: promoter primer (forward primer: 5'TGCAAAAACCTTACATATTTTCCTC 3', reverse primer: 5'AGGTCCCTCAGAAGGGTTGT 3 '); coding region primers (forward primer: 5'AACAGCTCCGATCCAAGAAA 3', reverse primer: 5'AGGAACCATCCACTGCAAGA 3'). Using tomato leaf gDNA as a template, PCR amplification was carried out with Phanta enzyme. All PCR products were detected by gel electrophoresis: PCR products were electrophoresed with 1% agarose added with EB (ethidium bromide) for 30 min under the voltage condition of 100-120V, and the final results were displayed on the gel imaging system.

[0143] The present invention retrieves the sequence of the SlbHLH59 gene in the resequencing data, and further uses the MUSCEL Alignment in the Geneious software to analyze the sequence variation of the SlbHLH5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses a SlbHLH59 gene capable of regulating the ascorbic acid content in a tomato fruit and an application method ofthe SlbHLH59 gene. A gDNA sequence of the cloned SlbHLH59 gene is shown as SEQ ID NO:1 in the sequence table, a cDNA sequence is shown as SEQ ID NO:2 in the sequence table, a protein sequence encodedby the gene is shown as SEQ ID NO:3, and a promoter sequence of a functional mutation site contained in the gene is shown as SEQ ID NO:4. According to the invention, the transcription factor SlbHLH59located on a chromosome 9 of a tomato has a significant function in regulating the accumulation of ascorbic acid in the tomato fruit by genome-wide association study (GWAS), and at the same time, thegene can enhance tomato resistance to oxidative stress. Therefore, the gene can be applied to the improvement of tomato quality, especially aspects of plant antioxidant and the like.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a SlbHLH59 gene for regulating the ascorbic acid content of tomato fruit and an application method thereof. Background technique [0002] At present, the existing technologies commonly used in the industry are as follows: [0003] Ascorbic acid (L-ascorbic acid, AsA), also known as vitamin C, is a water-soluble small molecule reducing substance. Disease prevention plays an important role. AsA can scavenge active oxygen free radicals produced in the human body, thereby preventing cancer; it can reduce the content of cholesterol in the blood, thereby preventing and treating diseases such as high blood pressure and stroke; it can prevent the formation of carcinogen ammonium nitrite, so it can prevent and reduce the incidence of cancer; it can be used as a cofactor to participate in the body's epigenetic modification enzymes, thereby regulating the abs...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12Q1/6895C12N15/11
CPCC07K14/415C12Q1/6895C12Q2600/13C12Q2600/156
Inventor 张余洋叶杰叶志彪李汉霞张俊红
Owner HUAZHONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More