Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Prostate cancer early diagnosis or prognosis evaluation marker lncRNA malat1 and application thereof

A technology for prostate cancer and prognosis evaluation, applied in the field of medical diagnosis, can solve the problems of early diagnosis of unexposed prostate cancer, undisclosed relationship between prostate cancer, etc., and achieves the effect of high sensitivity, specificity, and good indication effect.

Active Publication Date: 2019-01-08
上海晟燃生物科技有限公司
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CN103146688A discloses that serum lncRNA with a specific nucleotide sequence can diagnose prostate cancer, but does not reveal the relationship between lncRNA fragments from other sources and other nucleotide sequences and prostate cancer, let alone its association with early diagnosis of prostate cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prostate cancer early diagnosis or prognosis evaluation marker lncRNA malat1 and application thereof
  • Prostate cancer early diagnosis or prognosis evaluation marker lncRNA malat1 and application thereof
  • Prostate cancer early diagnosis or prognosis evaluation marker lncRNA malat1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] The main purpose of this example is to detect the content of each malat1 fragment of exosome-derived malat1 in serum, specifically including:

[0043] 1. Use an exosome extraction kit (QIAGEN: exoEasy Maxi Kit or miRCURY ExosomeKits; Thermofisher: Total Exosome Isolation Reagent from serum) to extract the total exosomes in the serum. The extracted exosomes were extracted with a ribonucleic acid extraction kit (QIAGEN company: miRNeasy Micro Kit) to extract all the ribonucleic acids in the exosomes. The extracted ribonucleic acid was converted into cDNA using a reverse transcription kit (Takara: PrimeScript™ II 1st Strand cDNA Synthesis Kit).

[0044] 2. Design primers for amplifying different fragments on malat1 according to the nucleotide sequence of malat1. The specific primer information is shown in Table 1. Utilize the primers shown in table 1 and carry out PCR reaction and agarose gel electrophoresis to described cDNA (electrophoresis result sees figure 1 ). fig...

Embodiment 2

[0048] The main purpose of this embodiment is to establish a method for quantitative detection of exosome malat1-1 fragments, the method comprising:

[0049] 1. Extract serum total exosomes and ribonucleic acid, and reverse transcribe the ribonucleic acid into cDNA (see Example 2 for specific methods).

[0050] 2. According to the malat1-1 sequence design, the probe used in conjunction with the upstream and downstream primers of malat1-1: wherein, the nucleotide sequence of the malat1-1 is:

[0051] TAGGGGATTTCAGGATTGAGAAATTTTTCCATCGAGCCTTTTTAAAATTGTAGGACTTGT (SEQ ID NO: 13)

[0052] The nucleotide sequence of the probe is: TCCATCGAGCCTTTT (SEQ ID NO: 14), the 5' end of the probe is marked with a FAM fluorescent group, and the 3' end is marked with an MGB modification group.

[0053] 3. A nucleic acid fragment of artificially synthesized malat1 is used as a nucleic acid standard, and diluted to a concentration of 5pg / μL, 1pg / μL, 0.5pg / μL, 0.2pg / μL, 0.1pg / μL, and the nucleic a...

Embodiment 3

[0057] The main purpose of this example is to evaluate the diagnostic effect of serum exosome-derived malat1-1 on early prostate cancer, mainly including:

[0058] 1. Call 299 subjects whose clinical diagnosis results have been confirmed, see Table 2 for specific information.

[0059] 2. Detect the serum exosome-derived malat1 of 299 subjects (see Example 2 for the detection method) and plasma MD-miniRNA (see the Chinese invention patent CN103146688B for the detection method).

[0060] 3. According to the diagnostic results of the subject, the copy number of exosome-derived malat1, and the concentration of plasma MD-miniRNA, ROC curves of the exosome-derived malat1 and MD-miniRNA were drawn respectively by SPSS13.0 software ( see image 3 ).

[0061] 4. Conclusion: Based on image 3 The results shown show that the AUC area (0.881), sensitivity and specificity of the ROC curve of serum exosome-derived malat1 are higher than the existing marker MD-miniRNA (AUC area is 0.756),...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a prostate cancer early diagnosis or prognosis evaluation marker lncRNA malat1 and application thereof. The marker is an exosome-derived long-chain non-coding RNA (lncRNA) malat1, has a good indicating effect on the early diagnosis of a prostate cancer, can realize the non-invasive detection on the prostate cancer and has higher sensitivity and specificity when being compared with a conventional prostate cancer non-invasive detection method, thereby clinically avoiding the unnecessary puncture biopsy for prostate cancer suspected patients. In addition, the marker alsohas a good prediction effect on the prognosis of the prostate cancer and favorably guides the recurrence monitoring and the early clinical intervention of the patients.

Description

technical field [0001] The present invention relates to the field of medical diagnosis, in particular, to lncRNA malat1, a marker for early diagnosis or prognosis evaluation of prostate cancer, and its application. Background technique [0002] Prostate cancer is a malignant tumor that seriously threatens men's health. Its morbidity and mortality peak around the age of 70, accounting for the second highest incidence of male tumors and the fifth highest mortality in the world. The incidence of prostate cancer in my country has been on a significant upward trend in recent years. According to the latest reports, the annual growth rate of the incidence and mortality of prostate cancer in my country is as high as 7.2% and 5.5%, making it the fastest growing tumor in my country. [0003] Early prostate cancer is limited to the capsule, but when the tumor spreads outside the capsule or distant metastasis, the treatment of the tumor is quite difficult and the prognosis is poor. Th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 王家亮
Owner 上海晟燃生物科技有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More