Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Humanized mouse podocyte model stably expressing AQP2 protein, and construction method and application thereof

A stable expression and cell model technology, applied in the field of bioengineering, can solve the problems of high cost and time-consuming, and achieve the effect of low cost, efficient expression and fast construction

Inactive Publication Date: 2019-01-25
山西省人民医院
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This type of method plays a very important role in the preclinical drug evaluation process, but there are also many shortcomings. The first point is that the establishment of a humanized mouse cell model that stably and efficiently expresses the target protein is not only time-consuming but also expensive. also relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Humanized mouse podocyte model stably expressing AQP2 protein, and construction method and application thereof
  • Humanized mouse podocyte model stably expressing AQP2 protein, and construction method and application thereof
  • Humanized mouse podocyte model stably expressing AQP2 protein, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Construction of AQP2-DYK vector

[0034] (1) Using human cDNA as a template, design primer sequences A1F and A1R, introduce two restriction endonuclease sites HindIII, amplify the AQP2 protein coding region by PCR, and obtain the amplification product of the 0.8kb target AQP2 fragment, The amplified product is reclaimed after 2% agarose gel electrophoresis the target AQP2 fragment, wherein, primer sequence and target AQP2 fragment sequence are as follows:

[0035] A1F:TAAGCTTGGATGTGGGAGCTCCGCTCCAT

[0036] A1R: AGGTGTTCGAAGGCCTTGGTACCCCGTGGCA

[0037] Target AQP2 Fragment:

[0038] TAAGCTTGGATGTGGGAGCTCCGCTCCATAGCCTTCTCCAGGGCTGTGTTCGCAGAGTTCCTGGCCACACTCCTCTTCGTCTTCTTTGGCCTCGGCTCTGCCCTCAACTGGCCACAGGCCCTGCCCTCTGTGCTACAGATTGCCATGGCGTTTGGCTTGGGTATTGGCACCCTGGTACAGGCTCTGGGCCACATAAGCGGGGCCCACATCAACCCTGCCGTGACTGTGGCCTGCCTGGTGGGCTGCCACGTCTCCGTTCTCCGAGCCGCCTTCTACGTGGCTGCCCAGCTGCTGGGGGCTGTGGCCGGAGCCGCTCTGCTCCATGAGATCACGCCAGCAGACATCCGCGGGGACCTGGCTGTCAATGCTCTCAGCAACAGCAC...

Embodiment 2

[0041] Example 2 Constructing a humanized mouse podocyte line stably expressing AQP2 protein

[0042] (4) Culture mouse podocyte AQP2 in three 6cm culture dishes, culture medium RPMI-1640 (10% FBS, 1% PS, 50-100U / ml Y-IFN), pH 7.2, 35-37 degrees, Cultivate in a 5% carbon dioxide incubator for 20 hours, and the cell density is 20%;

[0043] (5) 1 μg of plasmid AQP2-DYK prepared in Example 1 was transfected into the above-mentioned mouse podocytes by FuGENE6 Transfection (Promega Company) reagent, and cultured for 24 hours;

[0044] (6) Cultivate with G418 concentration 500ug / ml medium again, observe the death rate after 1 day, and cell death occurs, replace the medium with G418 concentration 500ug / ml every 3 days to continue the culture, and the original single cells form a cluster cell group after 15 days , select small cells and scrape them off, digest with 0.25% trypsin for 5 minutes, neutralize with 10vol.% fetal calf serum G418 medium with a concentration of 500ug / ml, and...

Embodiment 3

[0045] Example 3 Constructing a humanized mouse podocyte strain expressing AQP2 protein

[0046] In step (6), the culture medium that is 500ug / ml is cultivated with the G418 concentration again, and the culture medium that changes the G418 concentration after 3 days is 800ug / ml to continue cultivating. Other conditions are the same as in Example 2. After 40 generations of cell subculture, the cells can be The specific production rate of AQP2 was maintained at 18pg / cell / day, and the specific production rate of AQP2 was still maintained at 15pg / cell / day after the cells were passaged for 50 generations.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a humanized mouse podocyte model stably expressing AQP2 protein and a construction method and application thereof. The cell model is a cell deposited in China General MicrobialCulture Collection Management Center (CGMCC) and deposited under the accession number of CGMCC No.16201 or a progeny cell thereof. The invention also provides the application of the humanized mouse podocyte model stably expressing the AQP2 protein in the research of the AQP2 protein, the preclinical pharmacodynamics evaluation of the antibody or the drug screening and the like. The invention adopts suitable amplification primer and identification primer to construct plasmid AQP2-DYK, the mouse podocyte transfected by DYK was screened by G418 and positive clones. The cell model could not onlyexpress AQP2 protein stably and efficiently, but also could be constructed quickly and cheaply.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a humanized mouse podocyte model stably expressing AQP2 protein and its construction method and application. Background technique [0002] At present, studies have proved that one type of hereditary diabetes insipidus is autosomal inheritance, which is caused by the mutation of the Aquporin2 (AQP2) gene, and the mutation site 1731A>C. Therefore, theoretically, it is feasible to establish a cell model with high expression of humanized AQP2 protein. Generally speaking, we use humanized animals to verify the efficacy of monoclonal antibodies or other drugs that specifically target human-derived molecules and other related drug evaluations. Among them, humanized mice are commonly used experimental animals , and mainly through genetically modified methods. This type of method plays a very important role in the preclinical drug evaluation process, but there are also many sh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/85G01N33/68G01N33/569
CPCC12N5/0602C12N15/85G01N33/56966G01N33/68G01N2500/10
Inventor 李荣山黄波
Owner 山西省人民医院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com