Primer pair, primers, probe composition, reagent and kit for detecting canine parvovirus based on BTNAA (Body Temperature Nucleic Acid Amplification) system

Abstract

The invention discloses a primer pair, primers, probe composition, reagent and kit for detecting canine parvovirus based on a BTNAA (Body Temperature Nucleic Acid Amplification) system. The primer pair comprises an upstream primer and a downstream primer, wherein the sequence of the upstream primer and the sequence of the downstream primer are as shown in SEQ ID NO.1 and SEQ ID NO.2 in the soecification, specifically, the sequence of the upstream primer is TTCTGGGGGTGTGGGGATTTCTACGGGTACTTTC, and the sequence of the downstream primer is CTAACTAAATGCAACTCACTCATAGTATTAAC. The primer pair, primers, probe composition, reagent and kit for detecting the canine parvovirus based on the BTNAA (Body Temperature Nucleic Acid Amplification) system have the advantage that rapid, real-time, sensitive, accurate and convenient detection of the canine parvovirus is realized under the condition of body temperature (37 DEG C) in a fluorescent detection instrument with the temperature control function. Compared with a traditional PCR method, the primer pair, primers, probe composition, reagent and kit for detecting the canine parvovirus based on the BTNAA (Body Temperature Nucleic Acid Amplification) system have the advantages of being more convenient to use and rapider, and convenient, rapid and accurate detection of the canine parvovirus can be realized in pet stores without laboratory conditions, small pet clinics and remote areas lack of resources.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a primer pair, a primer and probe composition, a reagent and a kit for detecting canine parvovirus based on a BTNAA system. Background technique [0002] Canine parvovirus (Canine Parvovirus, CPV) belongs to the family Parvoviridae, a member of the genus Parvovirus, and has the typical morphology and structure of the genus Parvovirus. The structure of CPV is equiaxed, approximately spherical icosahedron, with a diameter of about 18nm to 26nm, round or hexagonal in appearance, and no capsule. CPV was first isolated from dogs suffering from diarrhea and hemorrhagic enteritis in 1977 by two American researchers, Eugster and Nairn (Appel M J et al., 1979). In the next few years, Australia, Canada, France, Italy, South Africa, Japan and other countries reported the virus one after another, and the virus was named as canine parvovirus (CPV) internationally, which is the most...

AI Technical Summary

Problems solved by technology

However, these technologies are highly dependent on sophisticated equipment, especially fluorescent quantitative PCR instruments, which make them mainly used in laboratories, and fail to help medical staff realize the rapid detection of canine parvovirus (CPV) on the spot

In addition, due to the high precision of the fluorescent quantitative PCR instrument, the entire experimental setup process is relatively complicated, so not only the experimental operation, but also the interpretation of the results requires professionally trained technicians to complete.

These shortcomings make fluorescent quantitative PCR difficult to promote in grassroots testing laboratories or units, so it is even more inconvenient to use in remote areas with scarce resources

Images